The definition of art

Pop February 09, 2020 at 04:06 19800 views 645 comments Philosophy of Art

I suspect most people know art is something like this, but not having a definition creates a particular reality. Art about art trivializes art. I don't believe art is trivial - its the thing that keeps me going. It allows me the freedom to follow my interests - limited only by my consciousness.



The definition of art:

The following two sentences are a definition of art. This definition of art is also a work of art:

 
“Art is an expression of human consciousness. Art work is information about the artist’s consciousness.”
 
This is true for all of time.

This is true across all cultures.

This definition does not impinge upon the artist's freedom, but does predict the limits of art

 
This definition can be negated by producing one work of art from all of history, including mental art work from the future, which it does not contain. I believe this is not logically possible.
 

Proof of the definition:

?1.    Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.

2.   Consciousness is not just awareness but all mind activity, interwoven with the subconscious. What art can be cannot exceed consciousness.

3.   Everything is reducible to information, as it is only from information that we can create mental constructs. This is widely accepted in science, and a grounding for the definition. 

4.   If everything is reducible to information, then so is art. It is true to say: art work is information.   

5.   Art work information is imbued with the artist's consciousness:  it arises out of their consciousness, and reflects their consciousness, and is limited in scope by their consciousness, in the past, present, and the future.

It follows:art work is information about the artist’s consciousness.

 
We can elaborate further:“Art is an expression of human consciousness. Art work is information about the artist’s consciousness" (Consciousness, as experienced, presents itself as a united singular entity interwoven with the subconscious.)

 
From the above, I believe, the definition is proven, however I add some thoughts below as explanation for my thinking for your consideration.

 
What is art?  The word art derives from the Latin "ars" (stem art-), which, although literally defined means "skill method" or "technique", also conveys a connotation of beauty.

It originally was a narrow range of things, but because the concept of art is not grounded in anything concrete, it’s repertoire over time could arbitrarily be broadened. Eventually art’s meaning extended to anything deemed art. Groundless constructs only require consensus to exist – to become reality, so right from the beginning there is ambiguity as to what art is.

 
Then this indefinite notion of art is further imbued with the value and meaning system of the person, resulting in a slightly different interpretation for everybody. This interpretation becomes something close to our heart, and we are ready to stand to defend it as an important reflection of our personality and consciousness.The result is a vague heartfelt idea of art as something of value that has skill, meaning and aesthetic interest, etc - which we feel the need to defend.
But this also varies between individuals.

 
This is the central difficulty of all art discourse; essentially we are talking about different things. We vaguely agree on a central concept, but we experience it differently When we understand how the notion of art is related to personality and consciousness, we can predict that two very different personalities, or cultures, must as a result of this difference, construct different conceptions of art. So the resultant discourse about art is immediately disagreeable, and if any progress is to be made, an agreement about art must first be made. We have all experienced this, and it is illustrated in the difference in the art of native cultures, subcultures, the art of the mainstream, and the elite.

 
Whilst the form of art diverges between individuals and cultures – what art conveys, in one important respect, does not. It always conveys the consciousness of the artist. At its simplest, consciousness is mind activity. Whatever form art work may take –it has always, and it will always reflect the mind activity of the artist. This makes a definition of art possible.

 
It is not yet possible to absolutely define consciousness, but quite a lot is known about it:  mind activity is an element of it. Consciousness is the  driver of human activity. Things do not exist until we become conscious of them. The focus of our consciousness against the backdrop of what is happening in the world tells others a lot about us.

 
Consciousness develops in a collective consciousness that we recognize as family, friends, and culture. We absorb the collective consciousness as well as contribute to it. The way we understand art is by querying the consciousness that led to the work in the context of the collective consciousness that exists at any given time. We ask what were the artist’s thoughts in making the work given the prevailing times. As Paul Gauguin famously put it; “Art is either plagiarism or revolution.” It either reinforces the collective consciousness or challenges it.

 
Understanding art in this way is applicable for all of time, across all cultures, and for all forms of art. But this fact is not generally recognized, it is thought, in some circles, that art cannot be defined, so a misconceived reality for art persists.

 
As an ungrounded variable mental construct art has developed through the ages and across cultures – growing broader and smarter, ever trying to outdo itself -reflecting humanities expanding and changing consciousness in its wake. So much so, that art has became something so varied and broad that it ultimately can only be described by the full possibility of human experience.

 
Human experience is a function of consciousness. I experience therefore I am, and I think therefore I am, are fundamental tenets of western thought. Together they add up to – I am conscious therefore I am. This confidence in our consciousness forms the foundation of our notions of reality.

 
Art needs to be free to explore our diverse and ever changing reality. But it needs to be recognized that reality is limited by consciousness, so art can never outstrip this – the best art can do to be progressive and relevant is to recognize how it is tethered to human consciousness.

 
Consciousness can be studied in the information art provides. The diversity of human consciousness is well illustrated whilst walking through an art fair.  The intellectually disabled reveal a different consciousness in their art. If we follow an artist’s development from early child hood to adult maturity - it is the depth and breadth of their consciousness that we see changing, reflected in the form of their art. Like others, I used to think art’s major role is to reflect on reality and the meaning of life, but I now understand art reflects consciousness, whose role is to create reality in order to maintain life!

 
Art always presents information in the format of information of the artist’s culture, through the prism of the artists mind. This has a slightly distortive affect on the cultural information presented, as it is an interpretation by the artist. The interpretation is tainted by their understanding, beliefs, prejudices, and skill, etc. This illustrates how art works are first and foremost information about the artist’s consciousness, and from this we infer the artist's world view, culture, and make inferences about them, and their work.

 
Art work can be something simple, but is typically an example of the best one can do. We see this in all of recorded history, and there is no evidence that this would have been different in prehistory. This is invariable across cultures, though the form of what is valued does differ, its function as an exemplary item does not. If we accept that art is typically one’s best conscious effort we can infer  that Jackson Pollock’s  Blue Poles, the statue of David , the cave paintings in Lascaux, outsider art,  music, drama, as well as all art ever made , has a common denominator as information about the artist's consciousness – held up for the world to see.
 

 According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us. Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning

 
The singular thing that life is concerned with is to maintain and continue itself, and consciousness facilitates this. It is the one thing we are always expressing. We express it when making art, and it seems art's function is to express our consciousness when we personally cannot - to express it at its best, express it to many, and into the future.

 This, I believe, would unify and integrate what art is, under this definition.

Damir Ivancevic

iamdamir.com

Comments (645)

IvoryBlackBishop February 09, 2020 at 22:33 ¶ #380768
Reply to Pop
I didn't understand all of what you wrote. Could you give a more consise verison regarding the main points?
Pop February 09, 2020 at 23:12 ¶ #380787
Brett put it well:

Art is humanities expression of itself.

Art gives us insight into the artist,



Art is a concrete manifestation of human thought – a manifestation into concrete form, of something that is ( ungrounded / virtual / computed / experienced emotionally / believed / valued / perceived / subconscious ) - consciousness
IvoryBlackBishop February 09, 2020 at 23:30 ¶ #380797
Reply to Pop
Fair enough, are you asserting that it's totally 'subjective', or that there aren't better or worse ways of making art, or that art relate to certain other axioms or principles, such as beauty, creativity and aesthetics?
Pop February 09, 2020 at 23:43 ¶ #380812
I'm saying its all about consciousness. Principles, beauty, creativity, aesthetics being sub facets of consciousness.
I'm not saying there are better or worse ways to make art - and maybe I'm saying all art is equal - just that whatever we make reflects our consciousness. Always has, always will. We cant escape it.

Consciousness is a very broad term. The broadest there is- hence the only one that can define art.
We don't understand fully what consciousness is, but there is much material in other parts of the forum.

Panpsychism and Buddhism are the only complete theories of consciousness we have. They both suggest consciousness is a fundamental property of the universe. From this perspective consciousness takes on a much deeper meaning.
Amity May 17, 2020 at 13:23 ¶ #413549
Quoting Pop
I am attempting to get the below published. I would appreciate any comments.


Interesting. You have far more substantive feedback on your other thread (linked below) - 22 pages and counting

The importance of a questioning title and an altruistic OP.
I've just read some excellent responses:

https://thephilosophyforum.com/discussion/7492/what-is-art/p1

How far on are you with publication?
I was wondering whether you had considered writing an 'Article' for this forum.
Given the contributions in the other thread, how would you acknowledge the posters - individually, collectively ?

I found this essay on 'Definitions of Art':

https://1000wordphilosophy.com/2014/05/05/definitions-of-art/
Pop May 19, 2020 at 05:49 ¶ #413967
Reply to Amity

I've had a look at your website and i like it. The 1000 word format sounds good. Ill submit something in the near future.

I originally tried to steer the thread in various ways, including the development of a definition, but these threads have a life of their own, so in the end I've stuck to my original definition.
The forum and the contributors, have been a wonderful help, I've placed a link to the thread on my website.

As an artist my main interest is to push the boundaries of art, and If the definition is true then this would set a boundary beyond which art could not push. Hopefully diverting it towards an exploration of consciousness.

Academic acceptance / reinforcement would be helpful, but exposure is more important, as this definition will either sink or swim in the mind of an end user. So I thank you for the invite.

Amity May 19, 2020 at 08:34 ¶ #413989
Quoting Pop
I've had a look at your website and i like it. The 1000 word format sounds good. Ill submit something in the near future.


Hi and just to clarify: it's not my website and I have no authority to invite anyone to write for it. The general invitation on this forum TPF is from @jamalrob. See:
https://thephilosophyforum.com/discussion/76/submit-an-article-for-publication

Quoting Pop
these threads have a life of their own

Indeed they have with mixed results. Sometimes going with the flow can bring inspiration. It was this little 'divertimento' that caused me to search for a definition of art :
https://thephilosophyforum.com/discussion/8264/divertimento-1-the-grammar-of-self

Quoting Pop
The forum and the contributors, have been a wonderful help, I've placed a link to the thread on my website.

Yes, it sure has its marvellous moments; here's to more of the same. I was wondering more about how anyone would acknowledge any quotes made by participants in any writing project.

Quoting Pop
As an artist my main interest is to push the boundaries of art,

Aside from the theory, how do you do this in practice ?
What do you paint and how ?

Quoting Pop
Hopefully diverting it towards an exploration of consciousness.


What kind of consciousness ? Edit: Strike that I've just reread your OP. Sorry to be so stoopid :yikes:
I am curious because currently there are at least 2 television programmes which involve what might be termed a 'collective creativity'. Both are having to work round the constraints of the coronavirus crisis.

1. https://www.channel4.com/press/news/graysons-art-club
2. https://www.bbc.co.uk/programmes/m000j45r

1. Is fantastic. Takes place at home. It explores and unleashes creative talent as isolated people come together to share experiences. Also celebs and a bit of teaching going on. I would say it is funny, serious and spiritual. Last night's theme was:
' View from my window'. So, a variety of perspectives and materials.
Grayson spoke to an older viewer/ participant whose painting he chose. He was clearly moved when she said it was her first attempt since primary school. Like so many she had been put down and off art because of a teacher. Now she simply drew from the heart with no rules. She didn't know if she was doing things wrong and she didn't care. She was moved to express herself and her situation.

2. A bit more of a professional masterclass setup:
'Life Drawing Live: drawing the Nation Together'.
Along with 6 amateurs in a vast studio, it includes viewers and celebrities. Last time I watched it was about painting nudes. Everyone is painting the same thing, the model.
And given rules.

I suppose this can be likened to the differences in writing format and criteria between Articles and Essays...or not.

The Essay website I linked to is more constrained than the TPF. Both have their merits. I think we could have both here but that's for @jamalrob and co to decide !

Quoting Pop
Academic acceptance / reinforcement would be helpful, but exposure is more important,


So, you could do both ! Follow the strict 1000 word academic format and/or create a more 'you' article with TPF whilst still being 'professional' of course.

I think that so many helpful and experienced posters here would love to see their thoughts reproduced in a more permanent way, such as an Article. Even if they don't want to write one themselves. What would that be if not an Individual Collective Creative Consciousness ? :chin:























Outlander May 19, 2020 at 12:15 ¶ #414017
Great video I enjoyed watching a while back. Entertaining, informative, and brings up a few points worthy of discussion.


https://youtu.be/bHw4MMEnmpc
Pop May 19, 2020 at 18:52 ¶ #414106
Reply to Amity Ha Ha , my bad. Thanks for the link anyway - I think its a clever format so will look into it anyway.
Quoting Amity
Yes, it sure has its marvellous moments; here's to more of the same. I was wondering more about how anyone would acknowledge any quotes made by participants in any writing project.


I suppose you would have to approach each person you quote? It could get very messy.

Quoting Amity
What do you paint and how ?

http://iamdamir.com/

Quoting Amity
What kind of consciousness ?


My preference would be the first kind that you mentioned. But I feel any efforts towards a better understanding of self would be beneficial. The second tv show is a start - at some point they will start questioning what they do and why.

Consciousness is the foundation of all that we do, yet we hardly understand it - how it creates a self interested reality, and why, amongst a myriad of other things. It seems great constructions are created on non existent foundations, so an exploration of these issues would benefit everyone, I believe, particularly on a world leader level.

Quoting Amity
I think that so many helpful and experienced posters here would love to see their thoughts reproduced in a more permanent way, such as an Article. Even if they don't want to write one themselves. What would that be if not an Individual Collective Creative Consciousness ? :chin:


It sounds like a good idea. Perhaps you could create an amalgam of favourite quotes article ?



Pop May 19, 2020 at 18:56 ¶ #414111
Reply to Outlander I was just thinking about a thread on beauty / aesthetics - can we ground it in anything concrete? - I suspect not
Amity May 19, 2020 at 19:10 ¶ #414117
Quoting Pop
Perhaps you could create an amalgam of favourite quotes article ?


Hah. That would be fun. Taking all the favourite quotes as presented in posters' profiles could be a start...
Seeing how they match up with their own behaviour and words.

I've noticed how some keep the same ones forever, like their names and pics. Others seem to change with the wind...
Perhaps for fun and need for change or not being able to make their mind up on self presentation...
Who cares ?

Unfortunately, I am all talk, encouraging others without taking action myself :sad:





Pop May 19, 2020 at 19:21 ¶ #414118
Reply to Amity Perhaps a thread where each member selects a favourite post ( not their own )?
Amity May 19, 2020 at 19:45 ¶ #414129
Quoting Pop
Perhaps a thread where each member selects a favourite post ( not their own )?


Go on then :cool:
I'm all done for now...
Hmmm.
An Art Gallery of Posters' Posts.
A Portrait of Philosophy.
Pop Art.
unenlightened May 19, 2020 at 20:28 ¶ #414138
Quoting Pop
The definition of art:


Why?
Define and control.

Don't.
Let.
Anyone.

Tell you what is art.

Because...

It' ain't philosophy. It's fucking the whole world.

Pop May 19, 2020 at 23:43 ¶ #414166
Reply to unenlightened

Not define and control, but describe and understand.

The status quo is what is fucking the world. It needs to be challenged - I'm doing what I can to that end.
EnPassant May 22, 2020 at 12:19 ¶ #414964
There is a difference between art and art work. Art is a process whereby the artist evolves and develops in terms of consciousness. Art is an inner journey. A art work is a physical image of this inner process. This physical image can be shared with others but art as 'expression' is only incidental. One can go on this inner journey without expressing anything (ie without showing the art works to anybody). Art certainly is not about 'expression' let alone 'self expression' (what a silly notion). It is about an inner journey. That art works express something to other people is a secondary thing. It is about sharing the experience, through the image. As an artist I never think I need to express anything. But I do need to create things.
kudos May 22, 2020 at 16:23 ¶ #415013
Thanks for posting this it is very interesting. I read something from the author St. Augustine about the word 'expression' that stuck with me and it is reminiscent of this,

What a quantity of such items my memory is stocked with, things discovered and kept ready for use, the kind of things we say we have learned already and continue to know. Yet if I forgo their retrieval, even for brief intervals, they sink out of sight again, sliding deep into some inner windings, and they must be pressed up out of that place and pressed again into knowable form. We must, that is reconnect them after their dispersion. This is what we mean by 'expression,' which comes from pressing, as 'exaction' comes from acting or 'extension' comes from tending.


In your view, does art include meaning, or is it separate from it? IE: are you only occupied with the meaning of art to the artist his or her self?
EnPassant May 22, 2020 at 17:21 ¶ #415026
Quoting kudos
In your view, does art include meaning, or is it separate from it? IE: are you only occupied with the meaning of art to the artist his or her self?


Not sure if you are asking me or Pop. Anyhow, for me, art is about meaning. Truth = meaning = beauty.
Beauty is truth. But a problem arises when people are asked what is beauty? The answer will be subjective. But for me, beauty is truth. But what is truth? and we are back to subjectivity.

Beauty and meaning can be shared by sharing the external, physical, work of art. But, for the artist, meaning is in the experience of creating. Art as 'expression' or 'reflecting society' (duh) are secondary things.

Art is creativity; for me the reason to create something is a conviction that it is worth creating. People say 'art is about reflecting society'. No, I don't think so, but when it does that is only incidental or secondary. Many artists create works that are different from the societies they live in. Michelangelo painted angels but in his time there were open sewers running through the streets.

I basically agree with Pop's definitions. Art is an inner process that is shared by means of the image.
kudos May 22, 2020 at 18:57 ¶ #415047
Reply to EnPassant The idea that "Art work is information about the artist’s consciousness," is sort of difficult for me to accept without qualification. If this were true, how could there be such a thing as art work to begin with? Because there would be no necessity for the artist to share information about their consciousness beyond some type of perversion. In addition, without some contribution from outward there can be no 'cast' of art in which to apply it's form.

We're on the same page that art (as it is commonly conceived) is something more introverted than extroverted. But the end result of it's form is in some part incidental, beyond being measurable from outside it is also a type of activity and not only a process of production. The 'work' part of artwork is not normally taken to refer to actual work or physical work, but seems to attribute a quantitative measure of it's end result thus allowing for the practical survival of the artist. It doesn't seem obvious to me that measuring the work itself could in any way derive the complete nature of art.
EnPassant May 22, 2020 at 20:18 ¶ #415057
Quoting kudos
The idea that "Art work is information about the artist’s consciousness," is sort of difficult for me to accept without qualification. If this were true, how could there be such a thing as art work to begin with? Because there would be no necessity for the artist to share information about their consciousness beyond some type of perversion. In addition, without some contribution from outward there can be no 'cast' of art in which to apply it's form.


I don't think it is perverse to want to share something good. It is natural. Yes, there are all kinds of influences that determine 'fashion' in art: art history, other artists, the world at large etc. But the essential aesthetic is deeper than fleeting fashions. As the OP says, art is about the artist's consciousness but the form of the image (art work) is often influenced by fashion in art. Art is creativity. An Art work is a bit messier when it comes to definitions because it has so many cultural influences.

When people say 'art' they are mostly talking about the image be it a painting or piece of music or sculpture. For me art is the inner process and the image/art work is a metaphor of that process.
kudos May 22, 2020 at 21:03 ¶ #415062
Reply to EnPassant If that's true then we should look to AI software, it would allow us to comprehend art better than our selves alone because it can better make use of information, data, and correlations to make inquiry into the nature of things. Nobody would take this claim seriously, because it misses the mark completely. It may perhaps not be what is meant, it would be clearer but less dramatic to say 'Artwork includes information about the artist's consciousness.' Information is power they say, and if this summarizes the concept of art then why would anyone just give power away to someone else for nothing? There must be more to it than that alone.
EnPassant May 22, 2020 at 21:31 ¶ #415063
Quoting kudos
Information is power they say, and if this summarizes the concept of art then why would anyone just give power away to someone else for nothing? There must be more to it than that alone.


I suppose the artist reveals a lot by sharing his/her thoughts but we do that anyhow.
Pop May 22, 2020 at 22:17 ¶ #415070
Quoting EnPassant
Art certainly is not about 'expression' let alone 'self expression' (what a silly notion).


That you feel the need to create something - what dose that express?

What is the mind activity that leads you to create art? Is it not your consciousness?
EnPassant May 23, 2020 at 09:19 ¶ #415161
Quoting Pop
That you feel the need to create something - what dose that express?

What is the mind activity that leads you to create art? Is it not your consciousness?


Yes, you could say consciousness. But the primary motivation is not expression, it is simply to create. I suppose expression is inevitable on some level but 'create' is the motivation. "Reflecting society" is also something that creeps in but doing art 'to reflect society' is journalism
kudos May 23, 2020 at 22:35 ¶ #415311
Reply to EnPassant I think you’re onto something with this. What the artist creates is not art proper, but, to paraphrase Kant, the arts in traditional western thought draw from something ‘before experience.’ Expression is one of its subprocesses where it joins with the human will. But art seems to be a composite of experience, or consciousness (not sure what the difference is in this context) including a type of rational framework and isn’t really ‘owned’ by any one particular.
Pop May 23, 2020 at 23:32 ¶ #415318
What is the mind activity that leads you to create art? Is it not your consciousness?
— PopQuoting EnPassant
Yes, you could say consciousness


The philosophy that aligns with my definition is a combination of idealism, monism, and IIT theory
( Tononi ). Theory is different to fact, however the outcome in this case is very easily tested.
To negate the definition, you need only to produce a work of art from the whole of time, from any culture, that is not information about the artists consciousness.

As you have agreed with the above statement, this would be a logical impossibility for you.

Quoting EnPassant
but 'create' is the motivation


If you familiarize yourself with IIT theory you will see how creativity is a function of consciousness. That is: consciousness unifies and integrates information, and I postulate - in a creative process. It seems consciousness is creativity.

I do not understand creativity that is not an expression of consciousness - please enlighten me.



EnPassant May 24, 2020 at 10:51 ¶ #415440
Quoting Pop
I do not understand creativity that is not an expression of consciousness - please enlighten me.


I'm talking about art in cultural terms. Generally speaking artists do not become seized with a desire to express something. It is more fundamental than that. It is a desire to create. It is a human need to feel that we create our own lives. Expression, in cultural terms, is just sharing the image (art work) with others. It is not the primary motivation. But it follows, naturally, because art inevitably expresses the contents of the artist's consciousness.

What I don't like is teachers telling art students things like 'art is about self expression' or ' art is about reflecting society'. These are not the primary motivations. The primary motivation is an innate need to create.

One of the great problems of modern capitalist society is that it does not cater for people's creative needs.
Pop May 25, 2020 at 00:50 ¶ #415662
Reply to EnPassant

I do not think we disagree on that much. I used to understand things as you do - almost word for word.
I see things through a slightly different paradigm now, and I think the view is clearer.

I'm trying to impress on you, but without much success, that consciousness is the root of creativity.
Consciousness unifies and integrates information.
Creativity unifies and integrates information
This bears thinking about.

Quoting EnPassant
It is a desire to create. It is a human need to feel that we create our own lives.


Nobody can take this away from you. But as times change and new information comes to hand we have to adjust.We create a slightly different joyous reality. I'm reminded of a Yogic saying. it goes something like this: Sacrifice everything for awareness, but never sacrifice awareness for anything. As it is people of high awareness who live on in the minds of the collective consciousness forever. People like Plato, Aristotle, Kant, etc and this is true also in the arts. Perhaps it is closer to the truth to say we live on - in the creations of their minds?

Thank you for your interest. I wish you all the best.

EnPassant May 25, 2020 at 10:20 ¶ #415816
Quoting Pop
I'm trying to impress on you, but without much success, that consciousness is the root of creativity.
Consciousness unifies and integrates information.
Creativity unifies and integrates information


Yes, I agree entirely. This is what the word 'inspiration' means. Making art works is about making metaphors, symbols and images of spiritual reality. We are conscious of spiritual reality and we make physical images of it. I think we are saying much the same thing.
remoku May 25, 2020 at 10:36 ¶ #415819


Isn't the general naming of art, taking a mertiable work and creating a group?

What's the difference between creativity and art?

The door of my wardrobe is unhinged and slanted from where I broke it - it looks like art(I say because I've seen a meritable work it relates to.)

Someone may like that.

It's not 'an expression' of myself.

I define art as demi- imagination, or anything thought about imaginatively.

But perhaps it's just a trend and there is no art. A painting is a painting, a skull - a skull.



Pop June 03, 2020 at 23:11 ¶ #420086
[b]Consciousness entangles, Integrates and unifies information.
It is the only mental faculty that dose so.[/b]

When it comes to creativity – it is consciousness that is creative, by entangling, integrating and unifying information in various ways. When it comes to imagination, it is consciousness that entangles, integrates and unifies the imagined information.

When it comes to deciding on a work of art ( painting ) it is consciousness that decides on the canvas. It is consciousness that decides on image.It is consciousness that decides composition. It is consciousness that decides on colour.It is consciousness that decides how to mix the colours and whether the hues are correct. It is consciousness that decides which brush you use and how you place the paint on the canvas. It is consciousness that decides how well you are going. . It is consciousness that decides when the painting is finished. And it is consciousness that decides if it is a success or not.

So in the end what is the painting an expression of?

When it comes to deciding what art is, it is consciousness that makes the call!

It is the fundamental mental function from which all thought arises, and this is what we express when making art –our consciousness!
deletedmemberrw September 15, 2021 at 16:18 ¶ #595232
For me, if it's not hard to make, it isn't art.
Pop September 15, 2021 at 23:05 ¶ #595463
Quoting RAW
For me, if it's not hard to make, it isn't art.


:up: For sure, for me, every painting is that masterpiece - the one just beyond my reach, that takes everything out of me, that is the best I can do, at that particular time. And when it is finished, if it ever is, then I move onto the next similar such struggle.

Welcome to the forum. :smile:
Philofile September 15, 2021 at 23:13 ¶ #595466
Quoting Pop
For sure, every painting is that masterpiece - the one just beyond my reach, that takes everything out of me, that is the best I can do, at that particular time. And when it is finished, if it ever is, then I move onto the next similar such struggle.


Do you paint?
Pop September 15, 2021 at 23:15 ¶ #595469
Quoting Philofile
Do you paint?


https://www.iamdamir.com/painting
Philofile September 15, 2021 at 23:17 ¶ #595472
Reply to Pop

Wow! Tomorrow (if not banned) I show some of mine. I maybe have a dream of your paintings... :smile:
Tom Storm September 15, 2021 at 23:18 ¶ #595475
Reply to Pop Why should it matter to anyone what art is? Personally, my hunch is that art is not the object itself but the culture around it.
Philofile September 15, 2021 at 23:35 ¶ #595481
Reply to Pop

I couldn't resist looking further. Apples in jars! That is true madness. Great! Ohoooh. Wife calls again... For the last time, she says... :smile:
Pop September 15, 2021 at 23:46 ¶ #595487
Quoting Philofile
Apples in jars! That is true madness


:up: That is how I am gifted :rofl:

I'll look forward to seeing your work.
Pop September 16, 2021 at 00:10 ¶ #595511
Quoting Tom Storm
?Pop Why should it matter to anyone what art is? Personally, my hunch is that art is not the object itself but the culture around it.


It matters a huge deal. When art is undefined it fragments into many things, such as what has happened in post modernism. When it was defined to some extent, during modernism, there was a vague central agreement as to what constituted good art. So art integrated somewhat around this understanding, and the best examples of this understanding, was good art. The owners of this understanding were artists and intellectuals, so progress in art was driven by the people central to it, and there was a largely united world vision of what constitutes good art.

Without this world wide central agreement art has fragmented into fiefdoms of art, where what constitutes good art is the domain of the most powerful, rather then the most knowledgeable, imo.
deletedmemberrw September 16, 2021 at 00:40 ¶ #595519
Quoting Pop
For sure, for me, every painting is that masterpiece - the one just beyond my reach, that takes everything out of me, that is the best I can do, at that particular time. And when it is finished, if it ever is, then I move onto the next similar such struggle.


Of course, as a professional concept artist I can relate to that, to me every new concept piece is a personal masterpiece, the best I can do at the moment.



Pop September 16, 2021 at 00:43 ¶ #595522
Quoting RAW
Of course, as a professional concept artist I can relate to that, to me every new concept piece is a personal masterpiece, the best I can do at the moment.


I've shown you mine, lets see yours? :lol:
deletedmemberrw September 16, 2021 at 01:02 ¶ #595527
Quoting Pop
I've shown you mine, lets see yours? :lol:


I mostly do hard surface/tech designs but began doing some creatures too.
Pop September 16, 2021 at 01:20 ¶ #595537
Quoting RAW
I mostly do hard surface/tech designs but began doing some creatures too.


:up: Nice.

I wish I had the technical knowhow for computer graphics. In game art would be so cool.

Thanks.
deletedmemberrw September 16, 2021 at 01:46 ¶ #595550
Reply to Pop Yeah, it's a nice creative educational (you learn a lot about a lot of different things) job, perhaps one of the best in the world. I'll remove the the link and images if you don't mind, not sure if it's allowed.
Tom Storm September 16, 2021 at 01:56 ¶ #595559
Quoting Pop
t matters a huge deal. When art is undefined it fragments into many things, such as what has happened in post modernism. When it was defined to some extent, during modernism, there was a vague central agreement as to what constituted good art. So art integrated somewhat around this understanding, and the best examples of this understanding, was good art. The owners of this understanding were artists and intellectuals, so progress in art was driven by the people central to it, and there was a largely united world vision of what constitutes good art.

Without this world wide central agreement art has fragmented into fiefdoms of art, where what constitutes good art is the domain of the most powerful, rather then the most knowledgeable, imo.


I would hate for there to be agreement as to what constitutes good art. Art is simply what people put on display and call art. Whether it is good or not only matters in certain shared contexts and perhaps in the art business where 'good' equals $..

Apart from some academics or cognoscenti, no one will ever much care about systems or classifications of artistic merit - what will endure is personal taste and/or the market which both in their own way determine what is good.

Now it might be that if you subscribe to philosophical idealism you may see art as being the pursuit of goodness, beauty and truth. Then you can potentially posit categories of objective aesthetics which art either embodies or does not. Kind of pointless from where I sit.


Pop September 16, 2021 at 02:10 ¶ #595570
Quoting Tom Storm
I would hate for there to be agreement as to what constitutes good art. Art is simply what people put on display and call art. Whether it is good or not only matters in certain shared contexts


An art created by a particular consciousness, will be appreciated by a likewise consciousness.
But not by an unlike consciousness.

This fact, prevents art from being arbitrary.
Philofile September 16, 2021 at 02:18 ¶ #595573
Quoting Tom Storm
Art is simply what people put on display and call art.


Tomorrow I'm gonna break a few treebranches artistically and if people wanna buy it...

I saw a documentary on Banksy. He sold his paintings on a market. People wouldn't buy from him. Not even if he lowered the price. If only had they known...
Tom Storm September 16, 2021 at 02:50 ¶ #595590
Quoting Philofile
Tomorrow I'm gonna break a few treebranches artistically and if people wanna buy it...


It's been done.
Tom Storm September 16, 2021 at 02:52 ¶ #595592
Quoting Pop
This fact, prevents art from being arbitrary.


That fact is arbitrary. What sensibility you have and what you are drawn to is an arbitrary fate of subjective experience.

Quoting Pop
by a likewise consciousness.


It's not consciousness - it's personal taste.
Philofile September 16, 2021 at 02:54 ¶ #595593
Quoting Tom Storm
It's been done.


Huh? Seriously? Then I'll tear some leaves apart and sprinkle them on an aquarium surface. With robofish. Programmed to devour leave. And then leave.
Pop September 16, 2021 at 05:12 ¶ #595683
Quoting Tom Storm
That fact is arbitrary. What sensibility you have and what you are drawn to is an arbitrary fate of subjective experience.


Quoting Tom Storm
It's not consciousness - it's personal taste.




How does personal taste arise? What is subjectivity a function of?
I like sushi September 16, 2021 at 06:04 ¶ #595725
@Pop I don't really see much here tbh. I would suggest putting forward other philosopher's definitions and thoughts about 'Art' and pointing out their limitations.

Once you've done that I would also suggest getting across what isn't 'Art'. The way you've put it - about 'consciousness' - just leaves me asking what 'expression of consciousness' means here compared to just plain old 'consciousness' ... that should only be dealt with at a later time once you've gone over definitions and thoughts that are already out there today (check aesthetics).

When you've done that I'd be interested to read what you've got :)
Pop September 16, 2021 at 06:25 ¶ #595738
Quoting I like sushi
Pop I don't really see much here tbh


That is obvious from what you have written.

This is a definition of art. It defines precisely what art provides - information about the artist's consciousness.

What is consciousness is what you seem to be asking? I have defined consciousness as "an evolving process of self organization". So when we put these two together we get: art is information about the artist's evolving process of self organization.

Make sense?
Tom Storm September 16, 2021 at 07:11 ¶ #595758
Quoting Pop
How does personal taste arise? What is subjectivity a function of?


No idea. Does anyone really know? Ususally you develop a taste based on what you get to experience and what out of that experience appeals and sometimes someone shows you things they like and you get to like those things too. Some tastes are intuitive and may not have an accessible explanation.

Lots of people have a personal taste that is absent and quite phoney - they think they should like things because that's whatever the in-group they wish to please likes.
I like sushi September 16, 2021 at 07:21 ¶ #595760
Reply to Pop You're failing to address what expressions of consciousness are not 'Art'. Stating that art is an expression of consciousness is not telling me what expressions of consciousness aren't 'Art'.

Also, be careful distinguishing between (or at least addressing as clearly and concisely as possible) the act of producing art, viewing art and objects regarded as art (tied into the former).
Nosferatu September 16, 2021 at 07:25 ¶ #595763
Quoting Pop
This is a definition of art. It defines precisely what art provides - information about the artist's consciousness.


That's your vision on art. What are the consciousnesses you are talking about? People? What about tribal art wrt to the gods?
Pop September 16, 2021 at 07:41 ¶ #595767


Quoting Tom Storm
No idea. Does anyone really know?


These are elements of your consciousness - of your self organization.


Quoting Nosferatu
That's your vision on art. What are the consciousnesses you are talking about? People? What about tribal art wrt to the gods?


This is a definition of art - it captures all art for all time, for all cultures. Lay out your own art chronologically and look at yourself evolving.

Quoting I like sushi
Pop You're failing to address what expressions of consciousness are not 'Art'.


Ha, ha. There are many expressions of consciousness, but only some are deemed to be art.

Quoting Pop
?1.    Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.
Tom Storm September 16, 2021 at 07:51 ¶ #595768
Quoting Pop
These are elements of your consciousness - of your self organization.


I think those are just words. Not sure they really connect to anything except as a figure of speech. You could also say, and with no greater meaning, that my tastes are elements of my psychological essence - of my personal identity. What does this contribute?
Pop September 16, 2021 at 07:54 ¶ #595770
Quoting Tom Storm
You could also say, and with no greater meaning, that my tastes are elements of my psychological essence - of my personal identity. What does this contribute?


An understanding of what art provides.
Tom Storm September 16, 2021 at 08:24 ¶ #595773
Quoting Pop
An understanding of what art provides.


This is interesting. Art provides something? How is this related to what we were saying?

So far I thought the point was that I have personal taste (such as it is). You asked where this comes from. I said this was elusive and suggested a few options. You then added that they are elements of consciousness and self-organization, which sounds like an unnecessarily sententious way of describing personal taste.

You write the following:

Quoting Pop
When it comes to deciding on a work of art ( painting ) it is consciousness that decides on the canvas. It is consciousness that decides on image.It is consciousness that decides composition. It is consciousness that decides on colour.It is consciousness that decides how to mix the colours and whether the hues are correct. It is consciousness that decides which brush you use and how you place the paint on the canvas. It is consciousness that decides how well you are going. . It is consciousness that decides when the painting is finished. And it is consciousness that decides if it is a success or not.


This seems to me to be an example of romantic, selective exaggeration. I would swap 'consciousness' with personal choice or taste (and resources) - how much money you have for materials may determine what is possible. Art is often derivative and/or influenced by and borrowed/stolen from others and lacking in invention and vitality - it is consciously contrived rather than the expression of (noble) consciousness as you are seem to be suggesting.

Do we need to work so hard at mystifying a very primitive impulse to make things and decorate stuff?

I like sushi September 16, 2021 at 09:12 ¶ #595785
@Pop My mistake? I thought you stated you wanted to 'publish' something. Either you editted that out or I'm confusing this with something else?

If you are wishing to publish this in some manner then this isn't really up to scratch regardless of the audience you're aiming at. If you want critique in that area I can give it. For philosophy forum anything goes really.

Either way have fun with it :)
VerdammtNochMal September 16, 2021 at 09:15 ¶ #595786
If I make a hyperreal painting of a vase with two bright flowers, three grass green leaves, one bud, black background and surreal lightning the what makes it different from a photograph?
VerdammtNochMal September 16, 2021 at 09:23 ¶ #595787
Quoting Tom Storm
I think those are just words. Not sure they really connect to anything except as a figure of speech. You could also say, and with no greater meaning, that my tastes are elements of my psychological essence - of my personal identity. What does this contribute?


Exactly! An art showing our relation to Nature and the gods (no relation at all, I hope, but the simple fact of acknowledging their being and presence), how can information interpret this? Or dissipative systems? Or entropy evolving on a rotating Earth, between heat and cold, day and night? The daytime breaths out. The nighttime inhales. How do you, @Pop, interpret Aboriginal art or the Hopi art? I like your paintings and understand them. But they reflect your view. It can't embrace all art. Well, it can, but then you destroy it.
TheMadFool September 16, 2021 at 09:25 ¶ #595788
So, @Pop, art is basically a window to the artist's mind. I've heard people say the same thing though not exactly in the same words as yours, nor do I recall anyone making this particular aspect of art the cornerstone of the subject, definitionally speaking. The way everyone seems to have treated this facet of art as trivial, unimportant, accidental suggests that even non-art fits this description.

It's possible that what you're really saying is anything to do with the human mind is art; after all, everything we think/speak/do provides a glimpse of our consciousness. If so, what's unrelated to consciousness is not art. How do you explain the warm, fuzzy feelings one gets when watching a sunset, the sky ablaze yellow, red, orange? A sunset isn't a human artefact ergo, not linked to consciousness at all and yet we're moved by it as much as we would be looking at the Mona Lisa.
VerdammtNochMal September 16, 2021 at 09:30 ¶ #595790
Quoting TheMadFool
It's possible that what you're really saying is anything to do with the human mind is art; after all, everything we think/speak/do provides a glimpse of our consciousness. If so, what's unrelated to consciousness is not art. How do you explain the warm, fuzzy feelings one gets when watching a sunset, the sky ablaze yellow, red, orange? A sunset isn't a human artefact ergo, not linked to consciousness at all and yet we're moved by it as much as we would be looking at the Mona Lisa.


I have to say that once in a while you say sensible things! :ok:
TheMadFool September 16, 2021 at 09:32 ¶ #595792
Quoting VerdammtNochMal
I have to say that once in a while you say sensible things! :ok:


I wasn't fishing for compliments but thanks.
VerdammtNochMal September 16, 2021 at 09:35 ¶ #595795
Quoting TheMadFool
I wasn't fishing for compliments.


I know. But still! Great words! Truly. Ohoh, another compliment... :smile:

I get to know you better each day. By words only!

RussellA September 16, 2021 at 09:38 ¶ #595798
Quoting Pop
Art is an expression of human consciousness


Does creativity originate in the brain, mind or consciousness.

There is some kind of relationship between the brain, mind and consciousness. There is the question of where creativity originates: the brain, mind or consciousness.

Consciousness cannot exist independently of a brain/mind, whereas a brain/mind can function independently of consciousness. IE, the brain/mind can be creative independently of consciousness. Art is one example of brain/mind creativity.

I agree that there is the question of whether my brain/mind would be creative, such as in creating art, without the driving force of consciousness. But even so, even if consciousness is the driving force, creativity still originates in the brain/mind.

After randomly imagining several marks of varying colours, sizes and shapes, I choose to paint that mark which is, for me, the most aesthetically pleasing. I am only conscious of whether a mark is aesthetically pleasing after having imagined it. IE, I am conscious of my brain/mind's creativity, not that my consciousness is creative.

The expression "art is the expression of human consciousness" seems to infer that art is a creation of consciousness, rather than, as I see it, consciousness being a "passenger" on the brain/mind's creativity.

IE, rather than say "art is an expression of human consciousness", one could perhaps say that "art is the conscious expression of the creativity of the brain/mind"
VerdammtNochMal September 16, 2021 at 09:49 ¶ #595802
Quoting RussellA
There is some kind of relationship between the brain, mind and consciousness.


The brain is the place where the mind, consciousness, emerge. The brain is a usefool tool. Matter only for outside observers. But with soyl content for the one interacting with it. Creativity and art and ideas origin there.
TheMadFool September 16, 2021 at 09:51 ¶ #595804
Quoting VerdammtNochMal
I know. But still! Great words! Truly. Ohoh, another compliment... :smile:

I get to know you better each day. By words only!


:ok: If that's what floats your boat, by all means, be my guest.
VerdammtNochMal September 16, 2021 at 09:57 ¶ #595808
Quoting TheMadFool
:ok: If that's what floats your boat, by all means, be my guest.


My boat is word filled
Playful and light
My hunger stilled
With words of joy and fright
Pop September 16, 2021 at 20:58 ¶ #596022
Quoting I like sushi
Pop My mistake? I thought you stated you wanted to 'publish' something.


Initially I did want to publish it, but then I changed my mind.

It is a scientific, irreducible, and falsifiable definition of art, something Wittgenstein gave up on, thinking it impossible. But the main thing it has going for it is that it is a work of art. It is a work of art defining and challenging art. It is conceptual art in the vein of Duchamp's urinal - by far my best work so far, so I would not be interested in changing it in any way.

Quoting I like sushi
Either way have fun with it :)


Am having a ball with it, thank you. :smile:
Pop September 16, 2021 at 21:07 ¶ #596032
Quoting Tom Storm
This is interesting. Art provides something?


Yes, art provides information about an artist's consciousness - we came full circle by way of questioning, since, it seems, you did not really understand what was meant by this.

Quoting Tom Storm
This seems to me to be an example of romantic, selective exaggeration


There is nothing romantic about this, just your misinterpretation. I am making the point, If everything is an expression of consciousness how can art not be? Making the point that expressing ones consciousness is an unavoidable fact.
Pop September 16, 2021 at 21:13 ¶ #596046
Quoting VerdammtNochMal
Exactly! An art showing our relation to Nature and the gods (no relation at all, I hope, but the simple fact of acknowledging their being and presence), how can information interpret this? Or dissipative systems? Or entropy evolving on a rotating Earth, between heat and cold, day and night? The daytime breaths out. The nighttime inhales. How do you, Pop, interpret Aboriginal art or the Hopi art? I like your paintings and understand them. But they reflect your view.It can't embrace all art. Well, it can, but then you destroy it.


At least you acknowledge this much. An artwork is information about the artist's evolving process of self organization. We dont know what self organization is, but it is this that ultimately all art expresses, regardless of time or culture. And we have spoken about this variously. What is being created is forms - endlessly variable, and open ended forms.
Pop September 16, 2021 at 21:44 ¶ #596065
Quoting RussellA
Does creativity originate in the brain, mind or consciousness.


I have defined consciousness as an evolving process of self organization, but I do not know what is the source of self organization in the universe, however I do know that it is this that art is expressing.
Pop September 16, 2021 at 22:10 ¶ #596070
Quoting TheMadFool
It's possible that what you're really saying is anything to do with the human mind is art; after all, everything we think/speak/do provides a glimpse of our consciousness. If so, what's unrelated to consciousness is not art. How do you explain the warm, fuzzy feelings one gets when watching a sunset, the sky ablaze yellow, red, orange? A sunset isn't a human artefact ergo, not linked to consciousness at all and yet we're moved by it as much as we would be looking at the Mona Lisa.


I have defined art in such a way as it could be defined. In irreducible terms, and at the same time defined the limits of art. I don't think my definition is something new to many practicing artists. What is new is that it has been done - in no uncertain terms! It is a conceptual artwork itself - literally, and intentionally.

Art can be far more then what I have defined it as. It can be awesome and inspiring, but it need not be anything much at all. I am highlighting that it is the consciousness of the artist that is special, not art per se. But I am not being judgmental in this. A simple consciousness will be appealing to simple people, so the success of art can not be judged from any particular perspective.

I am however, saying that being beautiful or ugly are optional elements of art. The elements I have identified are constants in art - all forms of it, for any culture and time. These are the elements present in every work of art. These are the elements Wit could not find, and so he gave up on a definition of art. Saying there were no constituent elements that make something art, so it is indistinguishable from anything else. But it is distinguishable by the consciousness of the artist!! Consciousness is unique in every instance, and it is information about this that art provides.
Tom Storm September 16, 2021 at 22:37 ¶ #596079
Quoting Pop
If everything is an expression of consciousness how can art not be?


You still haven't explained why this point matters. Essentially you are saying that anything done by humans is consciousness at work. If everything is consciousness, then art is no different to spitting on the floor. It's not a criterion of value, it's a criterion of everything and by implication, nothing.

Pop September 16, 2021 at 23:05 ¶ #596090
Reply to Tom Storm Please read my reply to Madfool, RusselA, Netzolief above.
Tom Storm September 16, 2021 at 23:20 ¶ #596100
Quoting Pop
I am highlighting that it is the consciousness of the artist that is special, not art per se


Sorry this just sounds confused. Again, what does it add to any understanding of art? You might as well say it is the talent of the artist that is special, not art per se. I don't see how idea the of consciousness provides anything useful. People have always tried to reduce art to single dimension - will, being, talent, personality, genius - your idea of 'consciousness' is just another one (perhaps an umbrella term of all of these) that doesn't really help us.

Art is always a reflection of who an artist is and what choices they make. Even when they are faking it...
Pop September 16, 2021 at 23:25 ¶ #596102
Reply to Tom Storm Well you can not say I haven't tried. :smile:
Tom Storm September 16, 2021 at 23:31 ¶ #596105
Reply to Pop I can't and I bear you no ill will. Just don't see your point. I am very interested in what people say about art. Even critics. :fire: Seems to me art and religion spawn the most elaborate theories and reactions.
Pop September 17, 2021 at 01:20 ¶ #596136
:up: No ill will in philosophy, just endless debate! :smile:

Quoting Tom Storm
?Pop I can't and I bear you no ill will. Just don't see your point. I am very interested in what people say about art. Even critics. :fire: Seems to me art and religion spawn the most elaborate theories and reactions.


Quoting Pop
This is the central difficulty of all art discourse; essentially we are talking about different things. We vaguely agree on a central concept, but we experience it differently When we understand how the notion of art is related to personality and consciousness, we can predict that two very different personalities, or cultures, must as a result of this difference, construct different conceptions of art. So the resultant discourse about art is immediately disagreeable, and if any progress is to be made, an agreement about art must first be made. We have all experienced this, and it is illustrated in the difference in the art of native cultures, subcultures, the art of the mainstream, and the elite.


One last try, and I am done.

Art is information about the artist's evolving process of self organization.

Philosophy can be defined in exactly the same way.

Philosophy is information about the philosopher's evolving process of self organization.

These are the constant elements in art and philosophy, everything else is optional - endlessly variable and open ended.

Tom Storm September 17, 2021 at 01:44 ¶ #596140
Quoting Pop
Art is information about the artist's evolving process of self organization.

Philosophy is information about the philosopher's evolving process of self organization.

These are the constant elements in art and philosophy, everything else is optional - endlessly variable and open ended.


Sorry, still doesn't work for me. There's nothing in the use of the word information or self-organization that informs the idea of art or philosophy. Again, you could equally say that 'all is information about the evolving process of personality' (which seems just as blandly true to me).

But the issue for me is, so what? What are you saying this concept provides you?

I also think there are additional problems in comparing philosophy with art. Can you compare say Rembrandt's The Night Watch with Kant's Critique of Pure Reason? They provide quite different experiences and share no common properties. To say they are both the product of the creator's evolving process of self-organization is kind of meaningless since it provides no insight into the creative process. Seems to me you're just renaming creativity as a process which it already is...

Maybe we can come to some other aspect at a later point. Take care.
Noble Dust September 17, 2021 at 03:03 ¶ #596155
Quoting Pop
Art is information about the artist's evolving process of self organization.

Philosophy can be defined in exactly the same way.

Philosophy is information about the philosopher's evolving process of self organization.

These are the constant elements in art and philosophy, everything else is optional - endlessly variable and open ended.


Artists and philosophers don't organize themselves the same way. Thus, art and philosophy, using your logic, are different.
Pop September 17, 2021 at 05:20 ¶ #596208
Quoting Noble Dust
Artists and philosophers don't organize themselves the same way. Thus, art and philosophy, using your logic, are different.


Are you serious? :chin:
Noble Dust September 17, 2021 at 05:22 ¶ #596210
TheMadFool September 17, 2021 at 05:26 ¶ #596211
Reply to Pop All I'm saying is this: There are many aspects of nature, where consciousness is not involved, that instill the same emotions as when viewing a human art piece. That seems to undermine your definition of art as all to do with the mind unless, of course, you also believe in god, the creator whose handiwork the universe is.

Also, in your attempt to find an essence, a leit-motif, to art, could you have immeserated rather than enriched the subject? Sometimes, it's better to not know than know.
Pop September 17, 2021 at 05:29 ¶ #596212
Quoting TheMadFool
?Pop All I'm saying is this: There are many aspects of nature, where consciousness is not involved, that instill the same emotions as when viewing a human art piece


How is this relevant to a definition of art? Can you produce an art work that is not captured by my definition?
TheMadFool September 17, 2021 at 06:12 ¶ #596237
Quoting Pop
How is this relevant to a definition of art? Can you produce an art work that is not captured by my definition?


1. Your definition is fantastic. It so happens that art as a window to the artist's mind isn't a new idea at all - many people have already made a mention of it in their writings - but what is novel, pleasantly surprising in my humble opinion, is for someone (you) to take this rather old intuition about art and turn it into something much more interesting - the very meaning of art itself. It's as if you want to tell all the art experts out there that the meaning/essence of art was there right under their noses and they couldn't see it. Kudos to you.

2. However, could there be a good reason why the experts didn't consider your definition as good enough to encompass all that art is? As I said, your notion of what art is - information on the mind of artists - is old news in the art world.
Pop September 17, 2021 at 06:44 ¶ #596246
Reply to TheMadFool It is a definition of art. When defining something you don't get a choice as to how it exists! :lol:

It is irreducibly defined. It may not be what you would like to hear. No doubt you would prefer to hear the typical irrelevant and subjective drivel, but such is the nature of the beast. The definition can not be reduced any further, and any expansion of it is not a constant characteristic of art. What is left, is what always exists.

So you are left with the bare bones, so that you can know precisely what art provides – every time you interact with an art work. It brings to the fore the pertinent aspect of what art is. Which, of course, is an expression of consciousness. Of course the question is - “what is consciousness” ?

Clearly a very dim and murky concept for some.

Quoting TheMadFool
As I said, your notion of what art is - information on the mind of artists - is old news in the art world.


There must be hundreds of definitions of art that I have read, but none are like this one, and when people speak of art, it is often a shambles because they understand it differently.
Ambrosia September 17, 2021 at 07:00 ¶ #596258
Reply to Pop
You are saying nothing new,and you original OP is overblown,flowery,dogmatic and verbose.

As a very broad loose brush the core of what you say is good.
You neglect the subconscious awareness and the primary fact that art is an expression of the artists desire,his politics,his vision,his intentions,his dreams,and most times his opium to cope with life.

You also seem oblivious to the fact that art can also be dishonest propoganda,and that mainstream art is in the main bourgeois hegemony.

Most art is opium. A coping mechanism for life,ditto metaphysics and theories.
High art is instructive and didactic.
Real art is extremely rare.
Pop September 17, 2021 at 07:02 ¶ #596259
Reply to Ambrosia And which of these eludes my definition ?
Ambrosia September 17, 2021 at 07:07 ¶ #596265
Reply to Pop
Your definition has no nuance and little precision.

It's like saying "all people eat food" ,what does my definition elude?

Your not the first in anyway to have this view,and worst your view is pedestrian,egotistical and preachy.

Try nuancing and applying your view with practical critiques of specific art pieces.

And to address the points and objections I made would be nice.
TheMadFool September 17, 2021 at 07:54 ¶ #596284
Quoting Pop
It is a definition of art. When defining something you don't get a choice as to how it exists! :lol:


Yet, someone can present anything under the sun as art. What's the difference between letting anyone determine what art is and you defining art as anything you want?

Quoting Pop
It is irreducibly defined. It may not be what you would like to hear. No doubt you would prefer to hear the typical irrelevant and subjective drivel, but such is the nature of the beast. The definition can not be reduced any further, and any expansion of it is not a constant characteristic of art. What is left, is what always exists.


I like your definition because it's, as a philosopher might say, broad - it must necessarily be so since it must cover all the bases and art is notorious for its complex diversity.

However, in your attempt to ensure all art falls within your definition, you've sacrificed on detail, an important element in a definition. By your reasoning, everything humans do is art, all that we do being information on our consciousness. Are you willing to accept that letter written by an ordibary person is art and it is as artistic as an epistle penned by a great writer cum calligraphist? After all both are information on the artist's consciousness.

Quoting Pop
Of course the question is - “what is consciousness” ?


Well, you have it as part of your definition of art. So, back to you, what is consciousness?

Quoting Pop
There must be hundreds of definitions of art that I have read, but none are like this one, and when people speak of art, it is often a shambles because they understand it differently.


It, art as expression of consciousness, doesn't appear in the definition because experts deem it trivial and not because they didn't know.

As I said, you making consciousness the cornerstone of art is novel.
RussellA September 17, 2021 at 15:26 ¶ #596446
Quoting Pop
“Art is an expression of human consciousness. Art work is information about the artist’s consciousness.”


There are many different definitions of "Art", of which the above is more relevant to the Post-Modernism that arose in the 1960's.

This definition doesn't relate to Modernism and Pre-Modernism

For example, "Art is an expression of human consciousness" is not referring to Kirchner's Expressionism, where the artist expressed their inner feelings, not their consciousness.

"I am however, saying that being beautiful or ugly are optional elements of art" is clearly not referring to the Modernism of Monet's Impressionism, which is about the aesthetic arrangement of representative forms.

"Art work is information about the artist’s consciousness” surely does not apply when looking at the Mona Lisa , which seems more about Lisa Gheradini's self-conscious reflections within the Lombardy countryside than any reference to the artist.

"Art is information about the artist's evolving process of self organization" certainly does not apply to a landscape by Thomas Cole, where no information is given about the process of the artist. It the landscape itself rather than the artist that is the subject of self-organization.

This definition relates more to Post-Modernism

If Art is about consciousness, then any conscious act can be art, such as the Post-Modernist Andy Warhol's Oxidation Series 1977, where he invited friends to urinate onto a canvas of metallic copper pigments, so that the uric acid would oxidize into abstract patterns.

If Art is about consciousness regardless of quality, then this would fulfil the Conceptual Art of Tracey Emin, where the concept or idea involved in the work take precedence over traditional aesthetic, technical, and material concerns.

If Art was about expressing the consciousness of the artist, this would include Cut Piece 1964 by Yoko One, a performance in which people were invited to cut away portions of her clothing.

If Art was about expressing the consciousness of the artist through the ideas and concepts of language, this would include the Language-based art of Joseph Kosuth, such as his 1997 work Titled Quotation (for L.C.) consisting solely of the text "SORRY, NO IMAGE AVAILABLE"


IE, the above definition relates more to that of the Post-Modernism that arose in the 1960's, where the artist has become more important than the artwork, rather than any definition of art that preceded it.
T_Clark September 17, 2021 at 18:16 ¶ #596500
Quoting Tom Storm
Art is simply what people put on display and call art.


In an earlier discussion of art a couple of years ago, we were thrashing around with what it meant. None of the responses really worked for me till Praxis wrote this:

Quoting praxis
If art is anything an artist presents as art then anything can be art, and by extension, anyone can be an artist. This is true, in my opinion, but all it really means is that presenting something as art is essentially offering an invitation to view something aesthetically. We may or may not have the ability or choice to do so. In any case, claiming that something presented as art is not art is a refusal to view it aesthetically and does not mean that it's not art.


I found that really helpful and I think it matches your view and expands it a bit.

I find this a really interesting subject and I've thought about it a lot. Once, while visiting a contemporary art museum with a visual artist friend, we got in a discussion with one of the museum guides about what art means. I took the position that art doesn't mean anything. My friend and the guide didn't buy that, but I've thought about it more since then and I think it works. Here's my formulation - art is something manmade which doesn't mean anything beyond the experience it gives you. Here's the example I generally give. It's about music, but I think the same thing applies to other arts. It's from "October Light" a book by John Gardner. It's long, so I've got it hidden.

[hide="Reveal"][i]Then it had come to him as a startling revelation-though he couldn't explain even to his horn teacher Andre Speyer why it was that he found the discovery startling-that the music meant nothing at all but what it was: panting, puffing, comically hurrying French horns. That had been, ever since- until tonight- what he saw when he closed his eyes and listened: horns, sometimes horn players, but mainly horn sounds, the very nature of horn sounds, puffing, hurrying, . getting in each other's way yet in wonderful agreement finally, as if by accident. Sometimes, listening, he would smile, and his father would say quizzically, "What's with you?" It was the same when he listened to the other movements: What he saw was French horns,. that is, the music. The moods changed, things happened, but only to French horns, French horn sounds.

There was a four -note theme in the second movement that sounded like ..Oh When the Saints," a theme that shifted from key to key, sung with great confidence by a solo horn, answered by a kind of scornful gibberish from the second, third, and fourth, as if the first horn's opinion was ridiculous and they knew what they knew. Or the slow movement: As if they'd finally stopped and thought it out, the horns played together, a three-note broken chord several times repeated, and then the first horn taking off as if at the suggestion of the broken chord and flying like a gull-except not like a gull, nothing like that, flying like only a solo French horn. Now the flying solo became the others' suggestion and the chord began to undulate, and all four horns together were saying something, almost words, first a mournful sound like Maybe and then later a desperate oh yes I think so, except to give it words was to change it utterly: it was exactly what it was, as clear as day-or a moonlit lake where strange creatures lurk- and nothing could describe it but itself. It wasn't sad,. the slow movement; only troubled, hesitant, exactly as he often felt himself. Then came- and he would sometimes laugh aloud- the final, fast movement.

Though the slow movement's question had never quite been answered, all the threat was still there, the fast movement started with absurd self-confidence, with some huffings and puffings, and then the first horn set off wit h delightful bravado, like a fat man on skates who hadn't skated in years (but not like a fat man on skates, like nothing but itself), Woo-woo-woo-woops! and the spectator horns laughed tiggledy-tiggledy­ tiggledy!, or that was vaguely the idea- every slightly wrong chord, every swoop, every hand-stop changed everything completely ... It was impossible to say what , precisely, he meant. [/i][/hide]

I don't think this contradicts Praxis' view. I like them both.
Thunderballs September 17, 2021 at 19:51 ¶ #596539
Art and artificial are closeky related. An artificial material is one made by people. If future generations (or aliens) find plastic in the soils of the Earth, not knowing much about history, they will be able to infer it's artificialkity. But is plastic art? Is art imitating? What it imitates? 'Life", so the western spectator exclaims in an uncanny certainty. Now what is meant by that? Test-tube life? Ni, of course not. The exoression of our most intimate feelings? How then? By painting, by sculpting, by collage? No. By singing. Is singing art? Opera? Maybe. Two simple tines, their following uo, can akready cause a tear in me to well (theme frim "Interstellar", that so-called Kip-and-science-based based movie with one fatal flaw). Is that art? Is it a movie that is art? Depends on the movie. Tarkovski is nice. Two men filmed while shitting and eating each other's shit? Art? Can be. Art can be an expression of a worldview. That means science is art and physics the uktimate art. But so are the dit-pantings in down-under ("way down under Australia, very different from overhere, getting rid of Abo's one by one, buy cheap land for uranium, iit reminds me of Sweden, got the same sort of freeze on, all the animals look so strange, all victims of a testing range...").
Pop September 17, 2021 at 20:07 ¶ #596548
Quoting Ambrosia
And to address the points and objections I made would be nice.


I have addressed the relevant points. It may surprise you, but I am not interested in your opinion of what a definition of art should be. Nor am I interested in your opinion of how well I write. I am only interested in whether the definition prevails, and I’m glad you have acknowledged that it does.

Quoting Ambrosia
It's like saying "all people eat food" ,what does my definition elude?


Aha, but it is not a definition of food is it? It is a definition of art, and it is absolutely nailed – definitive! It defines the boundary of art – all art, for all of time. And due to how we feel a sense of ownership about art, this presses peoples buttons. I do expand upon this in the definition body. This is a deliberate provocation on my part.

Quoting Ambrosia
Your not the first in anyway to have this view,and worst your view is pedestrian,egotistical and preachy.


It is a scientific, irreducible, and falsifiable definition of art ( Popper ) And at the same time it is a work of conceptual art in the vein of Duchamp’s urinal. Had you bothered to read some of the previous posts you would be aware of this. And you would be aware of my attitude to post modernism, and why I do this.

Quoting Ambrosia
You are saying nothing new,and you original OP is overblown,flowery,dogmatic and verbose.


Are you saying you have seen falsifiable definitions of art before? Show me?

Quoting Ambrosia
You also seem oblivious to the fact that art can also be dishonest propoganda,and that mainstream art is in the main bourgeois hegemony.


Without a definition of art. We can not be certain we are talking about the same thing in a conversation about art. Even with a definition this is a difficulty. The definition is not groundbreaking art news, as I have stated several times previously. However if we had a definition of art, then our understanding of art would self organize around the definition. The definition of art would become the powerful player in the question of what is art, and what is good art, rather than the people who currently are.

A definition of art, and I’m not saying my definition is necessarily it, has the potential to shift the power balance in the art world, back into the hands of the intellectuals and the artists. This is my primary goal. It is a long shot indeed! but what is there to loose? it is worth a try, imo.

The definition is useful in these potential ways rather then as something providing clarity about art, or the art world today - whose clarity, and integrity, at present, as you may know, was recently well represented by a banana nailed to the wall.
Thunderballs September 17, 2021 at 20:17 ¶ #596552
Quoting Pop
It is a definition of art, and it is absolutely nailed – definitive!


So you think. But the thoughts you see are not universal. You say they are. I say they're not.
Pop September 17, 2021 at 20:27 ¶ #596557
Quoting TheMadFool
Yet, someone can present anything under the sun as art. What's the difference between letting anyone determine what art is and you defining art as anything you want?


Please read my reply to Ambrosia above.

Quoting TheMadFool
Are you willing to accept that letter written by an ordibary person is art and it is as artistic as an epistle penned by a great writer cum calligraphist? After all both are information on the artist's consciousness.


The definition itself is intended as a work of art. The fact is : "art is an ungrounded variable mental construct" - Pop. Anything can be art - absolutely. But great art, whatever that may be, depends upon a great mind, whatever that may be.

Quoting TheMadFool
Well, you have it as part of your definition of art. So, back to you, what is consciousness?


I am working on it. Thus far consciousness is self organization, but what is the source of self organization? Whatever that is is what is being expressed as art. And I doubt very much anybody has made this connection before. Whilst art representing mind, is not new, what is mind is as murky in art circles as it is anywhere.

Quoting TheMadFool
It, art as expression of consciousness, doesn't appear in the definition because experts deem it trivial and not because they didn't know.


No, most definitions of art are rather shallow and trivial, and similar. I have read many of them. This one is different. This one defines art scientifically within a work of art. Nothing like it has been seen before.
Thunderballs September 17, 2021 at 20:32 ¶ #596559
Quoting Pop
But great art, whatever that may be, depends upon a great mind, whatever that may be.


"Whatever that means". Indeed. What does it mean?

Quoting Pop
No, most definitions of art are rather shallow and trivial, and similar. I have read many of them. This one is different. This one defines art scientifically within a work of art. Nothing like it has been seen before.


What's different? It doesn't address a single form if art. So not all forms (n)either.
Pop September 17, 2021 at 20:47 ¶ #596570
Quoting RussellA
IE, the above definition relates more to that of the Post-Modernism that arose in the 1960's, where the artist has become more important than the artwork, rather than any definition of art that preceded it.


In arriving at the definition, I looked for the things present in art always - for all time. This , of course is mind activity - art reflects mind activity. This allows art to be defined in terms of mind activity. It is the only constant about art. So the only way possible to define it. So, by defining art in terms of mind activity I was able to capture all art for all of time, as how can art not reflect the mind activity of the artist?

That art reflects mind activity, is an idea about 100 years old in art. But no definition of art, that I am aware of, exists to express this. Not in this way.

Quoting RussellA
This definition doesn't relate to Modernism and Pre-Modernism


It relates to all art ever. It is a scientific definition. It focuses on what is always present in art, stripped to the bare bones. Please read my posts above for more detail why.
Pop September 17, 2021 at 20:52 ¶ #596577
Quoting Thunderballs
"Whatever that means". Indeed. What doescit mean?


This is where the definition comes into its own. it tells us that the artist - audience relationship is a relationship of consciousness in relation to consciousness. Where what is great about any art is that another consciousness can relate to it, rather then any particular physical quality that the art can posses.
Thunderballs September 17, 2021 at 20:58 ¶ #596579
Quoting Pop
audience relationship is a relationship of consciousness in relation to consciousness.


Ýou mean people showing art to other people?
Pop September 17, 2021 at 20:58 ¶ #596580
Quoting Thunderballs
So you think. But the thoughts you see are not universal. You say they are. I say they're not.


My thoughts are not universal, but the underlying process giving rise to them is - self organization.

We are the same, just different in formation. Remember??
Wheatley September 17, 2021 at 21:01 ¶ #596582
I don't think Art (with a capital 'A') can be boiled down to a definition.

Here's Britannica's page on art. Link
Thunderballs September 17, 2021 at 21:08 ¶ #596585
Quoting Pop
We are the same, just different in formation.


But this doesn't address the different forms. It just says there are different forms. But that's a worldview too. It's universal for you. I believe in forms too. You would say it's no believe. But it is. That's universal. That people have different believes You would call them forms but that doesn't say anything about them, not about their shape, not about their relation to other forms (not their physical or neuronal-physical interaction), nor about their nature (sound, looks, is it face-like), nor their relation to Nature or God.
Pop September 17, 2021 at 21:08 ¶ #596586
Quoting Wheatley
I don't think Art (with a capital 'A') can be boiled down to a definition.


Art work is information about the artist's consciousness.

This is a definition of art that is falsifiable by providing an art work that it does not contain?
Thunderballs September 17, 2021 at 21:12 ¶ #596587
Quoting Pop
My thoughts are not universal, but the underlying process giving rise to them is - self organization.


But self organisation cannot stand on it's own. It needs to be immersed in the right habitat. So the habitat is even more universal. However that may be though, it diesn't say anything about art. Maybe expressing this view is a form of art (like you di in your paintings).
Pop September 17, 2021 at 21:12 ¶ #596588
Quoting Thunderballs
But this doesn't address the different forms. It just says there are different forms


The forms are endlessly variable and open ended, and so can not be defined. Art can not be defined in terms of it's forms, which is the mistake most people make, including Wit, when trying to define art. So they think art can not be defined.
Thunderballs September 17, 2021 at 21:15 ¶ #596590
Quoting Pop
The forms are endlessly variable and open ended, and so can not be defined


Most forms can be expressed in art.
Pop September 17, 2021 at 21:16 ¶ #596592
Quoting Thunderballs
But self organisation cannot stand on it's own. It needs to be immersed in the right habitat. So the habitat is even more universal


Self organization gives rise to order in the universe.

Who self organized first - God or us? :chin:
Thunderballs September 17, 2021 at 21:20 ¶ #596594
Quoting Pop
Self organization gives rise to order in the universe.

Who self organized first - God or us? :chin:


Yes, that's true. I need a bit more self-organisation myself... :smile:

Most structures in the universe are the result of an organization but not all are self-irganized. If I make a painting it doesn't self-organize. Nor do my photographs....
Thunderballs September 17, 2021 at 21:21 ¶ #596595
Quoting Pop
Who self organized first - God or us? :chin:


God
Wheatley September 17, 2021 at 21:24 ¶ #596598
Quoting Pop
a definition of art that is falsifiable

Who's going to gather all the data??
Pop September 17, 2021 at 21:28 ¶ #596601
Quoting Wheatley
Who's going to gather all the data??


Not sure what you mean. My point is that art must reflect mind activity - that is the constant in art - the only constant - everything else is variable and open ended, just like consciousness! How about that?

Quoting Thunderballs
Most structures in the universe are the result of an organization but not all are self-irganized. If I make a painting it doesn't self-organize. Nor do my photographs...


These are expressions of your self organization, but you are a function of universal self organization. :smile:

** So ontologically what are your paintings an expression of?
Wheatley September 17, 2021 at 21:31 ¶ #596605
Quoting Pop
My point is that art must reflect mind activity - that is the constant in art - the only constant - everything else is variable and open ended, just like consciousness!

Yeah, im not following you... :confused:
Pop September 17, 2021 at 21:38 ¶ #596610
Quoting Wheatley
Yeah, im not following you. :confused:


You can not avoid expressing your consciousness in any activity that you partake in, so how can you avoid it when making art? You can not. So, what art expresses, is the artists consciousness.

I have defined consciousness as "an evolving process of self organization".
So, what art expresses is the artist's evolving process of self organization.

This would seem to agree with observation, and it validates the logical coherence of the definition.
Wheatley September 17, 2021 at 21:39 ¶ #596611
Reply to Pop Good luck! :sparkle:
Pop September 17, 2021 at 21:51 ¶ #596612
Quoting Wheatley
?Pop Good luck! :sparkle:


:up: Gonna need it. :smile:
Wheatley September 17, 2021 at 22:09 ¶ #596627
Reply to Pop :lol:
Tom Storm September 17, 2021 at 23:49 ¶ #596659
Quoting T Clark
I find this a really interesting subject and I've thought about it a lot. Once, while visiting a contemporary art museum with a visual artist friend, we got in a discussion with one of the museum guides about what art means. I took the position that art doesn't mean anything.


Thanks for the thoughtful comments. Yes, I share Praxis' view and I was just throwing out a quick and dirty definition, mainly because I was slightly dismayed by the needlessly mystifying and lengthy account provided earlier. Second to religion, there is probably more cloying nonsense written about art than any other subject.
Tom Storm September 18, 2021 at 00:57 ¶ #596675
Reply to T Clark Incidentally, it interests me how often the question 'what is good art?' is often mistaken for the question, 'what is art?'. It’s as if a work can only be classified as art if it is 'good' - whatever that means. Which is why you might hear some person fulminate about Jackson Pollock - ‘That’s rubbish, my 8 year-old does better work!’ and all the usual inchoate cliches about the decadent and bereft qualities of modern, non-representational art.

Orson Welles, who I consider to be one of the great artists of the 20th century, stated in an interview (was it with Dick Cavett?) that he was one of those people of whom - 'I don't know anything about art but I know what I like.' - applies. If it's good enough for him...

John Dewey has interesting things to say about art.

"Art is not the possession of the few who are recognized writers, painters, musicians; it is the authentic expression of any and all individuality. Those who have the gift of creative expression in unusually large measure disclose the meaning of the individuality of others to those others. In participating in the work of art, they become artists in their activity. They learn to know and honor individuality in whatever form it appears. The fountains of creative activity are discovered and released. The free individuality which is the source of art is also the final source of creative development in time." Time and Individuality

T_Clark September 18, 2021 at 01:35 ¶ #596685
Quoting Tom Storm
Incidentally, it interests me how often the question 'what is good art?' is often mistaken for the question, 'what is art?'. It’s as if a work can only be classified as art if it is 'good' - whatever that means. Which is why you might hear some person fulminate about Jackson Pollock - ‘That’s rubbish, my 8 year-old does better work!’ and all the usual inchoate cliches about the decadent and bereft qualities of modern, non-representational art.


This makes me think of what Robert Pirsig said about art in "Zen and the Art of Motorcycle Maintenance." He said "Art is high quality endeavor." I used to like that, but now I find t doesn't represent what I want to say about art. Art is something, not just a quality of something. That's what I like about your and @praxis's way of seeing things. There can be low quality art. Bad art. I think that's important.

There used to be a Museum of Bad Art in Massachusetts. I never visited. It's closed now, but it still has a web page:

http://museumofbadart.org/

Quoting Tom Storm
Orson Welles, who I consider to be one of the great artists of the 20th century, stated in an interview (was it with Dick Cavett?) that he was one of those people of whom - 'I don't know anything about art but I know what I like.' - applies. If it's good enough for him...


Charles Montgomery Burns on the Simpson's said "I'm not art critic. I don't know anything about art, but I know what I hate."

Quoting Tom Storm
Art is not the possession of the few who are recognized writers, painters, musicians; it is the authentic expression of any and all individuality. Those who have the gift of creative expression in unusually large measure disclose the meaning of the individuality of others to those others. In participating in the work of art, they become artists in their activity. They learn to know and honor individuality in whatever form it appears. The fountains of creative activity are discovered and released. The free individuality which is the source of art is also the final source of creative development in time.


This is a bit too close to Pirsig's definition of art to me. I'm a pretty creative person. During most of my adult life, the primary place that came out was in my work. As an engineer, I did many things that I thought showed my individuality, creativity, but I don't think any of them were art. They were generally technical reports. They required as much of my creativity as the poetry I've written did.
Pop September 18, 2021 at 01:39 ¶ #596686
Quoting Tom Storm
Art is not the possession of the few who are recognized writers, painters, musicians; it is the authentic expression of any and all individuality

Quoting Tom Storm
The free individuality which is the source of art is also the final source of creative development in time."



:up: Yeah - Self organization!.

"The term self-organization refers to the process by which individuals organize their communal behavior to create global order by interactions amongst themselves rather than through external intervention or instruction" - sciencedirect

Tom Storm September 18, 2021 at 01:41 ¶ #596687
Reply to Pop Cool, maybe we'll crash into each other using Dewey as a banana peel...
Pop September 18, 2021 at 01:54 ¶ #596696
Quoting Tom Storm
?Pop Cool, maybe we'll crash into each other using Dewey as a banana peel..


:lol: Yeah, we were bound to self organize. :joke:

praxis September 18, 2021 at 02:37 ¶ #596705
Quoting T Clark
They were generally technical reports. They required as much of my creativity as the poetry I've written did.


Cool to hear someone describe it this way, as being creative is so commonly only associated with the arTIST.
Thunderballs September 18, 2021 at 08:13 ¶ #596772
Quoting Tom Storm
Orson Welles, who I consider to be one of the great artists of the 20th century,


I think his fooling of a whole nation was his biggest piece of art! Though as that citizen, Kane, he performed pretty good too. I have never understood though why that movie is considered the best of all times! I even rather look at the short movie of two men meeting at a deserted bar. They don't say a word (not exactly my style though) but their actions speak louder. Very loud! They start to undress, shit away on the bar, and even eat it! Made an impression on me! Is it realism? Is it a film noir? Fiction? Science fiction maybe? Or just shit?
Thunderballs September 18, 2021 at 08:17 ¶ #596773
Reply to Pop Quoting Pop
Yeah, we were bound to self organize


Pop! Enough! Go self-organize yourself! :joke:
RussellA September 18, 2021 at 13:23 ¶ #596846
Quoting Pop
Art is an expression of human consciousness


"Art" is expressed in human consciousness
My belief is that "art" is a combination of an aesthetic and representation. As "aesthetic" and "representation" are human concepts, then "art" is also a human concept. As humans are conscious of their concepts, then humans are conscious of "art" as a concept. IE, I agree that "art" is expressed in human consciousness.

But - every observed object is an "artwork"
As everything observed has some degree of aesthetic and representation, then everything observed is an artwork - a Rembrandt, a leaf on the ground, a sunset, a Renault Kangoo, a Derain, a computer keyboard, a Falcon Heavy, a sunset, a tin of baked beans, an unmade bed, a Picasso.

Though - artworks don't even need to be physical objects
Artworks can exist as an idea or a concept. My description of a sunset over a Norwegian forest is also an artwork. In 1960, the artist Stanley Brouwn declared that all the shoe shops in Amsterdam constitute an exhibition of his artwork. In conceptual art, the idea or concept behind the work is more important than the finished art object.

However - all artworks have a quality as all objects have a temperature
I am following previous comments to make my point.
TheMadFool - "Yet, someone can present anything under the sun as art"
Praxis - "If art is anything an artist presents as art then anything can be art, and by extension, anyone can be an artist"
Tom Storm - "it interests me how often the question 'what is good art?' is often mistaken for the question, 'what is art?"
T Clark - "There can be low quality art".

As every observed object has an aesthetic and representation, the terms aesthetic and representative are not binary, but rather have a subjective "quality". IE, as every object has a temperature, and this temperature can range from extreme heat to extreme cold, a Derain has a greater aesthetic than two sticks on the ground artistically placed, and a Thomas Cole has a greater representative content than two sticks on the ground in the shape of a mountain.

However - an artwork's quality is subjective
I agree that as aesthetic and representative content is subjective, there can never be an absolute standard by which artworks are judged, and there will always be argument as to the quality of an artwork. However, this being said, the degree of aesthetic and representative content does vary between artworks, even if there can never be any absolute agreement as to which of two artworks is the better.

In summary - the definition of art should include a reference to "quality"
As with Wittgensteins' "game", I agree with Wheatly that "I don't think Art (with a capital 'A') can be boiled down to a definition." As every observed object is an artwork, the definition "Art is the expression of human consciousness" is far too broad to be useful. The next step in improving the definition would be to include reference to a major distinguishing feature of art, ie, its quality. This is easier said than done, as, for a Modernist quality in art means one thing, and for a Postmodernist quality in art means something totally different.

IE, improving any definition of art by including reference to quality is perhaps where the task of defining art gets a bit tricky
TheMadFool September 18, 2021 at 14:25 ¶ #596858
Reply to Pop :up: Now that I gave this some thought, I fully agree with you. The reason is this :point: fountain ([url=https://en.m.wikipedia.org/wiki/Marcel_Duchamp]Marcel Duchamp)[/url]



The artwork in this case went through the following process:

Porcelain urinal (before) (not art) -> Marcel Duchamp's consciousness -> Porcelain urinal (after) (art)

The only difference between the porcelain urinal (before) [not art] and the porcelain urinal (after) [art] is Marcel Duchamp's consciousness.

Can you imagine what power artist's wield? What's next? Shit art? I'm serious of course.
Constance September 18, 2021 at 14:27 ¶ #596860
Quoting Pop
Art is humanities expression of itself.

Art gives us insight into the artist,



Art is a concrete manifestation of human thought – a manifestation into concrete form, of something that is ( ungrounded / virtual / computed / experienced emotionally / believed / valued / perceived / subconscious ) - consciousness

But then, what of the part of art that is not concrete? What of conceptual art? Sure, something concrete there, but the artwork is not just this; it is a concept. Isn't thought all by itself inherently art? Why do we need the concrete?
Thunderballs September 18, 2021 at 14:28 ¶ #596861
Quoting TheMadFool
The only difference between the porcelain urinal (before) [not art] and the porcelain urinal (after) [art] is Marcel Duchamp's consciousness.


Imagine my reconstruction of modern sex-dolls in the not so distant future. "Dada...dada..."

And how appropiate the video after the urinoir: Echoes, Pink Floyd
Pop September 18, 2021 at 19:18 ¶ #596920
Quoting RussellA
"Art" is expressed in human consciousness


:up:

Quoting RussellA
But - every observed object is an "artwork"


:up: If deemed to be so.

Quoting RussellA
Though - artworks don't even need to be physical objects


:up:

Quoting RussellA
However - all artworks have a quality as all objects have a temperature


:chin: Only when they are being observed, or when the temperature is measured.

Quoting RussellA
However - an artwork's quality is subjective


:up:

Quoting RussellA
In summary - the definition of art should include a reference to "quality"


:chin: I understand what you mean. It is a good point. It is the normal interpretation that leads people to think art is about aesthetics. Most art theory would say art objects posses innate qualities, but In consciousness theory, quality or qualia exists in the mind of the observer and not the object. This way the same work of art can be beautiful to one person, and ugly to the next. ( there is room for interpretation ) ( Colour, according to science, is not present in the external world.)

You bring up a great thread topic - "Does the quality of an artwork reside in the art work itself, or in the mind of the observer, or artist?"

This is a similar question to: Is the world mind dependent?

If we decide the quality of the art work resides in the mind of the artist, or observer, then this would invalidate probably 90% of historical art theory and definitions, and validate my own - in that an artwork is a meeting of one consciousness and another.

:up: I can see now how I haven't explained it very well.
Pop September 18, 2021 at 19:44 ¶ #596922
Quoting Constance
But then, what of the part of art that is not concrete? What of conceptual art? Sure, something concrete there, but the artwork is not just this; it is a concept. Isn't thought all by itself inherently art? Why do we need the concrete?


This is best answered through information theory. It seems information is something concrete such that it changes our neurology, such that we become conscious of it. So, an artwork can not be immaterial, it needs to be in the form of something material, including sound, such that we can perceive it. The form of the artwork interacts with the form of our consciousness - this interaction creates an experience, where the quality of the experience is normally attributed to the artwork, however we ourselves play the major role in creating it.

A thought itself is not immaterial either, it has it's neural correlates. This definition is an artwork. It comes close to what you are describing.
Pop September 18, 2021 at 19:54 ¶ #596927
Quoting TheMadFool
The only difference between the porcelain urinal (before) [not art] and the porcelain urinal (after) [art] is Marcel Duchamp's consciousness.

Can you imagine what power artist's wield? What's next? Shit art? I'm serious of course.


Duchamp was a great art thinker - a philosopher of art. Modern art asked the hard questions - where are we, who are we, why are we? And what is art? It turns out art can be anything deemed to be art. This is necessary so as not to restrict it, but it can also make it arbitrary, as Duchamp pointed out.

Whilst Duchamp's urinal is not obviously aesthetically pleasant as an artwork, as a statement it has been tremendously influential - far more successful then any of Duchamp's more traditional pieces. For many artist's - this urinal is a Mona Lisa! - a Masterpiece!
Thunderballs September 18, 2021 at 20:00 ¶ #596929
What about fame? Banksy stood in an artmarket selling his paintings. Nobody wanted to buy them. Even not with a discount. If only they knew...

And what about his landscape with an uniformed nazi sitting relaxed on a bench, enjoying the landscape? The homeless center he hang it in got 300 000 pop for it.
Constance September 19, 2021 at 00:18 ¶ #597089
Quoting Pop
This is best answered through information theory. It seems information is something concrete such that it changes our neurology, such that we become conscious of it. So, an artwork can not be immaterial, it needs to be in the form of something material, including sound, such that we can perceive it. The form of the artwork interacts with the form of our consciousness - this interaction creates an experience, where the quality of the experience is normally attributed to the artwork, however we ourselves play the major role in creating it.

A thought itself is not immaterial either, it has it's neural correlates. This definition is an artwork. It comes close to what you are describing.


I would put the entire enterprise of art creation in the mind. An object in the world is nothing at all until it is invested with meaning by an interpretative agency. You and I see the same cloud, but you see a camel, I see poodle. But wherein does the poodle/camel difference lie? A piece of driftwood floats by unremarkably, then I say, observe the contours, the way the shadows play on the surface, isn't the aesthetic affect interesting? The whole matter of what makes something art lies in the interpretative taking the object "as" art. The material presence is simply the medium, which is incidental.
Not sure why 'information' is helpful. Information is an affect-neutral term, and its connotative values are entirely counter to aesthetic possibilities.
Constance September 19, 2021 at 00:34 ¶ #597096
Quoting Pop
1.    Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.


Arbitrarily? That would mean art is nothing at all. Take a signifier in language: entirely arbitrary whether it is 'tree' or 'namu' that is used to designate that tall thing with leaves. Interchangeable, making no important distinction as a phoneme simpliciter. But when I take up an object as art, the "as art" is contingent on certain distinct features of the way it is taken up.
So no, not arbitrary at all.

Quoting Pop
Consciousness is not just awareness but all mind activity, interwoven with the subconscious. What art can be cannot exceed consciousness.


Now THAT is arbitrary, to pin art's limitations on what one is consciously capable of: Who? My possibilities are different from others'. What is consciousness if not an historically constructed agency? Thus, it is unfinished, indeterminate.

Quoting Pop
Everything is reducible to information, as it is only from information that we can create mental constructs. This is widely accepted in science, and a grounding for the definition. 

4.   If everything is reducible to information, then so is art. It is true to say: art work is information.


I can't imagine a worse word for talk about art. Plain, connotatively UNaesthetic. Like describing a fresh spring morning in terms of molecular bonding.

Quoting Pop
5.   Art work information is imbued with the artist's consciousness:  it arises out of their consciousness, and reflects their consciousness, and is limited in scope by their consciousness, in the past, present, and the future.


Why not all this, but leave the artist's consciousness out of it? After all, art is as it is perceived, and the artist is just ONE perciever.
Thunderballs September 19, 2021 at 00:38 ¶ #597098
What about animal art? They build pretty things.
Thunderballs September 19, 2021 at 00:52 ¶ #597103
Quoting Constance
. Like describing a fresh spring morning in terms of molecular bonding


Oh how fresh and anew this springy information structure tickling my sensory forms, making my emotion entropy rocketing skinfo high. My emotional neuronal patterns run bezerk when I breath in these moisty misty forms. Whirlings of bloodflows inside me respond intensely to the morning magic sunlight waves entering me through my glassy eyeball spheres. Projected widely and vast over the retina in full formation. I wished I could make all other structures in formation experience the same conscious patterns I experience in-and outside me, my body structure being their willing and voluntary in-between prisinor. O jah! All formations in the world, rejoyce! And be in!
Pop September 19, 2021 at 02:45 ¶ #597147
Quoting Constance
You and I see the same cloud, but you see a camel, I see poodle.

:up: :lol: From my perspective I see the poodle.

Quoting Constance
The material presence is simply the medium, which is incidental.
Not sure why 'information' is helpful. Information is an affect-neutral term, and its connotative values are entirely counter to aesthetic possibilities.


Yeah, the material art form is a private ( but can be public ) language invented by an artist ( in modern art ) very similar to the words we now exchange, and also interpret.

Information theory describes this same process of me imbuing a message with meaning, and you interpreting the message, but with slightly altered meaning. The information has to exist in some physical form in order for this to happen.

Quoting Constance
So no, not arbitrary at all.


I understand where you are coming from, but strictly speaking, anybody can deem anything to be art.
It doesn't happen often, but this is a definition of art, so this needs to be taken into account.

Quoting Constance
Thus, it is unfinished, indeterminate.


That is the intention. Consciousness is endlessly variable and open ended - just like art. How about that? As consciousness changes, so does art historically. A different consciousness creates different art, etc. And on the audience side, it is the same ( as described above ) So art is a meeting of consciousness, where the success of a piece depends on this relationship, rather then on any particular form present in the art work.

Quoting Constance
I can't imagine a worse word for talk about art. Plain, connotatively UNaesthetic. Like describing a fresh spring morning in terms of molecular bonding.


:rofl: I, on the other hand, get so tired of the subjective nonsense I hear about art. But you see, I need to be severely logical to define something. If done successfully, then a definition can be used to predict, and I think this one can do that. It is what makes it different, what makes it interesting, imo. The world is full of romantic drivel about art, what it lacks is a definition.

Quoting Constance
Why not all this, but leave the artist's consciousness out of it? After all, art is as it is perceived, and the artist is just ONE perciever.


Art about art, creates a certain reality for art. Whereas a definition of art refocuses art to the question of "what is consciousness". And there starts a journey of self discovery, and perhaps discovery of what it is all about, such that it brings back some meaning to the question of what is art. As you have intimated, it is all consciousness, so there are no limits to this question absolutely. I have defined consciousness as a process of self organization, but I do not know what self organization is - the whole universe is self organizing. And this is also what all art is expressing. There are no limits to the form of self organization that we can take, but in understanding this we come to understand ourselves better, and perhaps also what it is all about??
Thunderballs September 19, 2021 at 04:15 ¶ #597189
Quoting Pop
I understand where you are coming from, but strictly speaking, anybody can deem anything to be art.


One can deem indeed. The real art is to let others think this too

.Quoting Pop
Art about art, creates a certain reality for art.


You must convince others first. Your information approach is not accepted by most people.
Constance September 19, 2021 at 14:24 ¶ #597449

Quoting Pop
Yeah, the material art form is a private ( but can be public ) language invented by an artist ( in modern art ) very similar to the words we now exchange, and also interpret.

Information theory describes this same process of me imbuing a message with meaning, and you interpreting the message, but with slightly altered meaning. The information has to exist in some physical form in order for this to happen.


You say it has to have physical form, but does an idea have physical form? That's a loaded question; look: you set out to define art, that means talk about its essence, what makes art, art. You would need to do what holds for language: the medium is just the catalyst, the vehicle through which art is communicated. But the real event is interior, in the interpretative milieu of mind. Also, you would need to identify what this essence is. Is it form? And what is meaning as an aesthetic idea, not what language produces fit for a dictionary.
See Dewey's Art as Experience or Clive Bell's Art. Perhaps you're aware of these. Have you read Danto, or George Dickey?
The reason I am saying this is that art is certainly NOT information in its essence. There may be an informational dimension to it, just as classical music needs a score, but the score is not the art (though it may assessed on other aesthetic grounds). Sorry, but I just don't see this.

Quoting Pop
I understand where you are coming from, but strictly speaking, anybody can deem anything to be art.
It doesn't happen often, but this is a definition of art, so this needs to be taken into account.


Anything can be art, true. But what makes it art when we say, that's art? Driftwood in a pond is not art. But then, I say it is quite beautiful. This is an aesthetic judgment. What happened to the driftwood itself? Nothing. It happened in me.
When I call the driftwood art, this is not an arbitrary judgment. The reason why anything can be art is that all things possess something that evoke an artistic response. What IS that?

Quoting Pop
That is the intention. Consciousness is endlessly variable and open ended - just like art. How about that? As consciousness changes, so does art historically. A different consciousness creates different art, etc. And on the audience side, it is the same ( as described above ) So art is a meeting of consciousness, where the success of a piece depends on this relationship, rather then on any particular form present in the art work.


Grant you that. We don't know what art is in any definitive way (though, the metaphysics of art has a say here. After all, what is value, aesthetics?) But my point is that calling it information does not further enlightenment.

Quoting Pop
I, on the other hand, get so tired of the subjective nonsense I hear about art. But you see, I need to be severely logical to define something. If done successfully, then a definition can be used to predict, and I think his one can do that. It is what makes it different, what makes it interesting, imo. The world is full of romantic drivel about art, what it lacks is a definition.


One don't want to say what art is with romantic drivel, but then, romantic drivel is amind the thing the definition has to address. And what does predicting something have to do with defining art? Does this mean with your theory, an object that comes up can be measured by a reliable standard to make the determination as to whether it is art or not? How?
That subjective nonsense has to stay where it is, unless you go deeper into the foundation of art. The more your ideas rise above the particulars of cultural entanglements, the less contingent it gets. But here, the same objection comes up: The most general, foundational view of what art is, as with "art is significant form", has to be about what the aesthetic is and this is a question of value. Without talk of the aesthetic, then it might as well be talk about talk, about words, symbols, and their dictionary meanings. This is why Clive Bell insisted significant form was what evoked "aesthetic rapture" which, as you know, varies, hance that annoying subjective nonsense when you move from the general to the specific.

Quoting Pop
Art about art, creates a certain reality for art. Whereas a definition of art refocuses art to the question of "what is consciousness". And there starts a journey of self discovery, and perhaps discovery of what it is all about, such that it brings back some meaning to the question of what is art. As you have intimated, it is all consciousness, so there are no limits to this question absolutely. I have defined consciousness as a process of self organization, but I do not know what self organization is - the whole universe is self organizing. And this is also what all art is expressing. There are no limits to the form of self organization that we can take, but in understanding this we come to understand ourselves better, and perhaps also what it is all about??


Art is a manifestation of self organizing, but so is language. And, of course, anything and everything can be art, and this is certainly true for language. But why do you think the analysis of the nature of art rests with organizing? The driftwood above is transformed into art at the immediate, perceptual level, and the receiving mind is an organized agency, but what is experienced is not organization.
You sound like a formalist, like Clive Bell (above).

Incidentally Pop, I can be pretty plain spoken and direct. Some can be offended. You handle this very well.







Constance September 19, 2021 at 14:28 ¶ #597450
Quoting Thunderballs
Oh how fresh and anew this springy information structure tickling my sensory forms, making my emotion entropy rocketing skinfo high. My emotional neuronal patterns run bezerk when I breath in these moisty misty forms. Whirlings of bloodflows inside me respond intensely to the morning magic sunlight waves entering me through my glassy eyeball spheres. Projected widely and vast over the retina in full formation. I wished I could make all other structures in formation experience the same conscious patterns I experience in-and outside me, my body structure being their willing and voluntary in-between prisinor. O jah! All formations in the world, rejoyce! And be in!


Oh freddled gruntbuggly, Thy micturations are to me, As plurdled gabbleblotchits, On a lurgid bee, That mordiously hath blurted out, Its earted jurtles, grumbling Into a rancid festering confectious organ squealer. [drowned out by moaning and screaming] Now the jurpling slayjid agrocrustles, Are slurping hagrilly up the axlegrurts, And living glupules frart and stipulate, Like jowling meated liverslime, Groop, I implore thee, my foonting turlingdromes, And hooptiously drangle me, With crinkly bindlewurdles,mashurbitries. Or else I shall rend thee in the gobberwarts with my blurglecruncheon, See if I don't!
RIP Douglas Adams
baker September 19, 2021 at 14:40 ¶ #597453
Art is for snobs.
Thunderballs September 19, 2021 at 15:08 ¶ #597467
Quoting Constance
Oh freddled gruntbuggly, Thy micturations are to me, As plurdled gabbleblotchits, On a lurgid bee, That mordiously hath blurted out, Its earted jurtles, grumbling Into a rancid festering confectious organ squealer. [drowned out by moaning and screaming] Now the jurpling slayjid agrocrustles, Are slurping hagrilly up the axlegrurts, And living glupules frart and stipulate, Like jowling meated liverslime, Groop, I implore thee, my foonting turlingdromes, And hooptiously drangle me, With crinkly bindlewurdles,mashurbitries. Or else I shall rend thee in the gobberwarts with my blurglecruncheon, See if I don't!
RIP Douglas Adams


Is this someone's epitap (epithap?)?
Thunderballs September 19, 2021 at 15:30 ¶ #597478
Quoting Constance
Art is a manifestation of self organizing


Please! Don't start also! I mean, @Pop is a nice guy (girl?) but one pop is more than enough... :grin:
Gogol September 19, 2021 at 15:47 ¶ #597482
Art is an umbrella term,a flexible word for expressions that are beautiful,funny or entertaining. Inspiring racous passionate!

It's obviously subjective ( as are all things!) But there is a lot of intersubjective agreement. ( for honest people! )

To say art is information without recourse to talking about feelings and aesthetics is the height of anti artistry!

The OP is boring,banal,non artistic,the definitional opposite of art! And far worse than duchamps urinal!

Art is an overwhelming expression of desire and ideology!

Anti art AKA shit art is science most politics and most philosophical discourse!!! Banal wannabe scribbling!

Finally,for the real artists in this thread (!!!) there are two types of art. "Cruel art" and FUN Art.
Cruel art is the bible,nietzsche,Greek tragedy.
Fun Art is Karl Krauss,all great comics,all great Satirists all Love Poets.

Scientists,philosophers,linguists,political administrators,academics,keep your dirty definitional hands off art! You know shit about art!!!
Your expressions and definitions are the excrement of your Soul!!! Passionless piss!
Gogol September 19, 2021 at 15:50 ¶ #597484
The scientist,the politician,the scribbler,the academic,the philosopher,ALL
Failed artists! Trying to take their revenge,the jealous schmucks!
Constance September 19, 2021 at 17:57 ¶ #597551
Quoting Thunderballs
Please! Don't start also! I mean, Pop is a nice guy (girl?) but one pop is more than enough... :grin:


You missed the point.
read on.
Constance September 19, 2021 at 18:19 ¶ #597568
Quoting Gogol
Art is an umbrella term,a flexible word for expressions that are beautiful,funny or entertaining. Inspiring racous passionate!

It's obviously subjective ( as are all things!) But there is a lot of intersubjective agreement. ( for honest people! )

To say art is information without recourse to talking about feelings and aesthetics is the height of anti artistry!

The OP is boring,banal,non artistic,the definitional opposite of art! And far worse than duchamps urinal!

Art is an overwhelming expression of desire and ideology!

Anti art AKA shit art is science most politics and most philosophical discourse!!! Banal wannabe scribbling!

Finally,for the real artists in this thread (!!!) there are two types of art. "Cruel art" and FUN Art.
Cruel art is the bible,nietzsche,Greek tragedy.
Fun Art is Karl Krauss,all great comics,all great Satirists all Love Poets.

Scientists,philosophers,linguists,political administrators,academics,keep your dirty definitional hands off art! You know shit about art!!!
Your expressions and definitions are the excrement of your Soul!!! Passionless piss!


I rather like what you said here. I think Dewey was right, if you want a philosopher who, though not passionate at all, found out why art cannot be pinned: it is because the aesthetic is an integral part of experience itself. All experience, whether I am pondering a thesis,peeling potatoes or painting a masterpiece, is inherently aesthetic. The artist is the one who takes this inherent aesthetic and brings it out, showcases it, amplifies it. Picasso paints the Old Guitarist and what has he done? He augments with the lowered head, the waste of ages etched in his emaciated features. We all feel this, know this without being artists, but Picasso really laid it out there, made this empathy into a spectacle. That is what art does. Whistle a tune and it's catchy. Now let Dvorak take it to romantic heights. The art is always, already there, you could say, in the world, in the interest we take in things mundane or profound, in the tying of a shoe properly, andin the our gait as we stride down the street (but the dancer with grace and expression sets the heart aglow).

Art is not to be defined not because everything can be art (though this is true) but because everything already IS art. Even the concept and the proposition. Art IS this emotion, this ghastly reaction: Is that really a can of human shit?? (Piero Manzoni). It issues from what is always already there.
praxis September 19, 2021 at 19:44 ¶ #597592
Quoting Constance
... the aesthetic is an integral part of experience itself ... everything already IS art.


This could use some explaining, don't you think?
frank September 19, 2021 at 20:00 ¶ #597596
Reply to Constance
I agree, but would add that art usually has a frame around it, or a museum to hold it, a display case over it, etc. Something to hand it forward for the consideration of the audience.

You can put your own invisible frame around the lines on the highway if you like, I suppose, but then it's your own private art.
Tom Storm September 19, 2021 at 20:04 ¶ #597598
Quoting praxis
Cool to hear someone describe it this way, as being creative is so commonly only associated with the arTIST.


I often find myself making a distinction between craft and art. Is a pair of exquisite, hand made shoes an example of art or craft? I tend to go with the latter, because the experience isn't just aesthetic, but must also be practical and be located in a lineage of other such traditional artifacts. Is a great and talented chef an artist or a craftsperson? We often throw the word 'artist' around as a type of free-range compliment - the barista down the road from me is called an artist by people in our office, etc.
Pop September 19, 2021 at 21:04 ¶ #597622
Quoting Constance
Incidentally Pop, I can be pretty plain spoken and direct. Some can be offended. You handle this very well.


No problem at all. :smile: You raise reasonable objections in an intelligent manner - what more can one ask for?

Quoting Constance
the medium is just the catalyst, the vehicle through which art is communicated.


:up: Art is an expression of human consciousness. It seems we agree on this, just disagree on the language perhaps.

Quoting Constance
See Dewey's Art as Experience


Dewey says something similar to me, but in romantic language:

"The free individuality which is the source of art is also the final source of creative development in time."

Let me translate: The self organization of the individual which is the source of art, is also the source of all self organization in time - universally. In other words, this element that is being expressed in art, has its ontological roots in the self organization of the universe. What the universe expresses and what art expresses are the same thing. It seems to me this is the pinnacle of what can possibly be expressed, and any talk of aesthetics just diminishes and confuses this.

Quoting Constance
But the real event is interior, in the interpretative milieu of mind. Also, you would need to identify what this essence is. Is it form? And what is meaning as an aesthetic idea, not what language produces fit for a dictionary.


Identifying that art is an expression of consciousness does this, but then to say consciousness can only exists in respect to aesthetics, or in line with some limited conception of subjectivity, is an error, as consciousness is open ended and will continue to grow, in ways we cannot imagine, and art will reflect this.

Quoting Constance
The reason I am saying this is that art is certainly NOT information in its essence.


Everything is information from every perspective. All the disciplines are coming around to understand this. It is the way of the future my friend! :smile: There is a thread open, and I will post more in time, if you are interested in joining the conversation. The information game is just a notch deeper then Wit's word game, imo.

Quoting Constance
And what does predicting something have to do with defining art? Does this mean with your theory, an object that comes up can be measured by a reliable standard to make the determination as to whether it is art or not? How?


The definition defines the elements present in art "always - for all time" and discards the elements that are only sometimes present in art. Art work understood as information about the artists consciousness is valid for the first cave art, and it will be valid for the last art ever created, as well as all art in between. It is the only element that is constant in art - all the other elements - aesthetics, subjectivity, beauty, etc are endlessly variable and open ended, so art can not possibly be defined in terms of them, as they are not always present, and the forms of them that will be present in future is unpredictable. It is a definition of art, not a subjective response to what are the best things about art, as most art oratory and definitions seem to be.

Quoting Constance
But why do you think the analysis of the nature of art rests with organizing?


Self organization is a concept in Systems Theory that is a place holder for the source of all creation in the universe. Systems theory is pretty much a theory of everything, especially when coupled with emergent information theory. It is a way of seeing what it is all about.

It brings up such questions as who "self organized" first - God or us?

Art expresses this self organization. Most art theory is oblivious to it. I'm surprised by Dewey's intuition though, given he predates these theories. I'm not surprised by his romantic expression however - it reflects the collective consciousness at the time. His work too is information about his consciousness.
By focusing on how consciousness is expressed, you start to understand why the form of something is the way it is, and perhaps start to understand what makes art Art.
Constance September 19, 2021 at 21:26 ¶ #597636
Quoting praxis
This could use some explaining, don't you think?


Yes, of course:

All experience, whether I am pondering a thesis,peeling potatoes or painting a masterpiece, is inherently aesthetic. The artist is the one who takes this inherent aesthetic and brings it out, showcases it, amplifies it. Picasso paints the Old Guitarist and what has he done? He augments with the lowered head, the waste of ages etched in his emaciated features. We all feel this, know this without being artists, but Picasso really laid it out there, made this empathy into a spectacle. That is what art does. Whistle a tune and it's catchy. Now let Dvorak take it to romantic heights. The art is always, already there, you could say, in the world, in the interest we take in things mundane or profound, in the tying of a shoe properly, andin the our gait as we stride down the street (but the dancer with grace and expression sets the heart aglow).

Art is not to be defined not because everything can be art (though this is true) but because everything already IS art. Even the concept and the proposition. Art IS this emotion, this ghastly reaction: Is that really a can of human shit?? (Piero Manzoni). It issues from what is always already there.
praxis September 19, 2021 at 22:24 ¶ #597670
Reply to Constance

None of that explains how “the aesthetic is an integral part of experience itself.” In the etymology of the word aesthetic, it at first only meant perception. Maybe you mean it like that? Perception is an integral part experience.
Pop September 19, 2021 at 23:28 ¶ #597692
Quoting Constance
It issues from what is always already there.


:up: In systems theory what is always there - what is common to all systems, is self organization.
In information theory, it is information that self organizes. In Yogic logic this self organizing element present in everything is consciousness.

I have said art work is information about an artists consciousness, and I have defined consciousness as an evolving process of self organization. So art work is an expression of the artists evolving process of self organization. This IS the something that is always there. There are no other somethings always there. All the other somethings are variable, and open ended - and continually emerging.

I think we just misunderstand each other rather then disagree. Perhaps disagree on expressive style. :smile:
Constance September 20, 2021 at 03:26 ¶ #597759
Quoting frank
I agree, but would add that art usually has a frame around it, or a museum to hold it, a display case over it, etc. Something to hand it forward for the consideration of the audience.

You can put your own invisible frame around the lines on the highway if you like, I suppose, but then it's your own private art.


The way I see it, the pothole in front of my house is a nuisance and an obstacle to my daily affairs. But then, ask me what I think of it from the perspective of art, and I will say, hmmm, let me see, the curvature of the line meets the dark middle, reminiscent of a spider's web, and the cloudy middle a kind of abstract lair.....; whatever. I say this is exactly what happens when we see the Mona Lisa. I know I am in the Louvre, I know Devinci painted it, and it is art, so I am there to assess what is before me AS art. But make a print of it. put it on a rug where I feet are wiped and we forget it's art. It's a rug. An intruder enters the house and I grab the rug an assault him.
The "artwork" lies in taking something AS art. But then the final question remains a mystery: what is it to take something as art?
praxis September 20, 2021 at 04:10 ¶ #597767
Quoting Constance
The way I see it, the pothole in front of my house is a nuisance and an obstacle to my daily affairs … we forget it's art. It's a rug.


What about your claim that the aesthetic is an integral part of experience itself? You seem to be describing situations where there is not an aesthetic experience.
Tom Storm September 20, 2021 at 04:20 ¶ #597769
Quoting Constance
The "artwork" lies in taking something AS art. But then the final question remains a mystery: what is it to take something as art?


It's not much of a mystery. What is it to take anything as anything, as people are wont to do? Humans are meaning making creatures and we like decorative things and we enjoy making statements and we see patterns and meaning in ordinary items. We have a ready facility towards the aesthetic and it takes little to activate this.
RussellA September 20, 2021 at 11:14 ¶ #597852
Quoting Pop
"Does the quality of an artwork reside in the art work itself, or in the mind of the observer, or artist?"


I agree with Pop "the quality of the art work resides in the mind of the artist, or observer" and Constance "I would put the entire enterprise of art creation in the mind. An object in the world is nothing at all until it is invested with meaning by an interpretative agency." (y)

As I see it, today in the West, there are two main approaches to the practice of art, what I may as well call the postmodernist and the modernist.

A background to postmodernism
The postmodernist approach began in about the 1960's and includes artworks such as Warhol's brillo boxes, Carl Andre's bricks and Tracy Emin's unmade bed. Major aspects include i) the idea of the artwork is more important than the physical artwork ii) any aesthetic has been deliberately removed iii) any representation is symbolic rather than pictographic.

A background to modernism
The modernist approach goes back to the first art created in the stone age between 300,000 and 700,000 years ago, and includes artworks such as Monet's Impressionism, Casper David Friedrich's Romanticism, Classical Greek sculpture and the wall paintings in the Lascaux caves. Major aspects include i) the artwork is more important than the artist ii) the aesthetic is of equal importance to the representation iii) the representation is pictographic.

The definition of "art" has been hijacked by the postmodernists
Even though postmodernism in art has existed for only the last 60 of the 700,000 years that humans have practised art, and probably 80% of contemporary artists work in the modernist rather than postmodernist style, the definition of "art" has unfortunately been hijacked by the postmodernists who now run the "Artworld". This is the same nihilistic doctrine of Derrida's postmodernism that dominates the humanities and media and rejects the established structure of Western civilization and culture.

Where does meaning reside in artworks
As modernist artworks are fundamentally aesthetic form of pictographic representation, and as postmodernist works are fundamentally symbolic representations, the question whether meaning resides in the artwork or the observer may be reduced to asking where meaning resides in i) aesthetic form ii) pictographic representation and iii) symbolic representation.

Where does meaning reside in aesthetic form
An aesthetic is a particular variety in balance. As Frances Hutchinson wrote “What we call Beautiful in Objects, to speak in the Mathematical Style, seems to be in a compound Ratio of Uniformity and Variety; so that where the Uniformity of Bodys is equal, the Beauty is as the Variety; and where the Variety is equal, the Beauty is as the Uniformity”

The aesthetic is in the relationship between the parts. This raises the question of the ontology of relationships in the world - do relationships exist in the world or do they only exist in the mind of the observer. FH Bradley argued against any reality of relations between things in his regress argument. He presented the dilemma to show that external relations are unintelligible. Either a relation R is nothing to the things a and b it relates, in which case it cannot relate them. Or, it is something to them, in which case R must be related to them.

Either relations do or do not exist in the world.
a) If relations don't exist between things in the world, then the aesthetic, which is a particular relationship between things cannot exist in the world within the artwork, and therefore can only exist in the observer's mind.
b) If relations do exist between things in the world, then there would exist relationships between every single part of the object presented as an artwork, and beyond countable, meaning that an aesthetic - understood as a particular relationship between particular parts - would become indistinguishable from every other set of possible relationships.

IE, an aesthetic cannot exist within the object presented as an artwork, but only in the mind of the observer.

Where does meaning reside in pictographic representation
Pictographic representation can vary from the photorealism of Ralph Goings 1970 McDonalds Pickup representing American culture, to the abstracted water-lilies of Monet and to the drum in Ghanain art representing goodwill and diplomacy.

Taking the abstracted water-lily of Monet as an example, a patch of pale blue contained within a circle of dark blue, the question is, can the shapes on the canvas have a meaning independently of any observer. Pictograms are a language, where the individual shapes within a pictogram are like the letters within a word. Taking the analogy of language, does the word "house" have a meaning independent of any observer. Clearly no, as a German, for example, could never discover any meaning in the letters by themselves, as words have to be learnt.

Similarly, do the symbols of a patch of pale blue within a circle of dark blue have any meaning independently of any observer, or does the meaning have to have learnt. If the shapes have meaning independently of any observer, then the fact that a mass of pale blue represents a water-lily must be internal within the mass of pale blue. But, a patch of pale blue can represent anything the observer wants it to: water, a sky, the feathers of a bird, the concept of peace, etc. Therefore, the fact that the patch of pale blue represents a water-lily cannot be within the shape itself but only in the mind of an observer.

IE, the meaning of a pictographic representation is not within the representation but within the mind of the observer.

Where does meaning reside in symbolic representation
Taking the example of Joseph Kosuth's One and Three Chairs 1965, consisting of a chair, a photograph of a chair and a dictionary definition of a chair, where the observer is invited to philosophically question in the spirit of Plato the nature of reality and the observer's place in society.

Any observer entering the gallery and seeing a chair could never discover from any inspection of the chair the artist's intended meaning, but only by reading about the artist's intentions.

IE, in such an artwork, the meaning of a symbolic representation cannot be discovered in the object itself, but only in the mind of the artist, and through a textual description then into the mind of the observer.

Summary
For both postmodernism and modernism, as the meaning of any artwork resides in the mind of the artist or observer and not the artwork, and as quality is a mental concept, then the quality of the artwork resides not in the artwork but in the mind of the artist, or observer
Tom Storm September 20, 2021 at 11:26 ¶ #597855
deleted
frank September 20, 2021 at 11:37 ¶ #597857
Quoting Constance
The "artwork" lies in taking something AS art. But then the final question remains a mystery: what is it to take something as art?


I see what you're saying.
Tom Storm September 20, 2021 at 12:02 ¶ #597862
Reply to RussellA Quoting RussellA
Summary
For both postmodernism and modernism, as the meaning of any artwork resides in the mind of the artist or observer and not the artwork, and as quality is a mental concept, then the quality of the artwork resides not in the artwork but in the mind of the artist, or observer


How do you understand a given artistic work through this position? Does a work not provide the observer's mind with something to consider?
Christoffer September 20, 2021 at 12:24 ¶ #597868
I would say that the purest definition of art is:

A creation created intentionally as an expression with the intent of a receiver experiencing it.

Everything else starts to dig into how people subjectively define art. But this definition denies agents that are unaware of what they do to be artists, since a monkey drawing, a tree formed by evolution etc. shouldn't be considered "artists". We can appreciate the end result of their output, but they are unaware of that output being experienced as a form of expression and are unaware of having made it with any such intent. A computer AI that is fully self-aware and "wants" to create art in order for people to experience it, is indeed an artist. A computer algorithm AI that scans millions of pictures to form a collage animation that looks dreamlike, is not an artist.

Art has to have the intent of it being art with the focus on being experienced by another agent. Any deviance from it removes every common trait that is connected to definitions of art. If someone creates an art piece and it is not experienced by anyone, not even the artist himself, then it is not art, but how can an artist create something without experiencing it themselves? So art becomes art just by making it with the intent of someone experiencing it, in this case, the artist themselves. But even if it were possible to create art without experiencing it yourself, as soon as it is discovered, it is art, as the intention was there from the beginning.

If people start discussing what art is based on the quality of craft and such, that is not the definition of art, that is the definition of craft. And craft can be somewhat objectively judged, art can't. But as a form of definition, the question of "what is art?" is a pretty basic definition.

The more interesting question is, how does the perceiver's experience of the art define the artwork itself in relation to the artist's intention? If an accident reshapes the artwork after the artist's death, but people have forgotten that the accident happened, how would this new experience exist or be defined when neither the artist's intention nor the perceiver's experience truly correlates.

praxis September 20, 2021 at 14:38 ¶ #597903
Quoting Constance
The "artwork" lies in taking something AS art. But then the final question remains a mystery: what is it to take something as art?


To see something aesthetically.

You’ve claimed that the aesthetic is an integral part of experience itself, however, which seems to mean that we always view things aesthetically. Clearly that is not the case, so once again I’m asking what you mean by that claim.
frank September 20, 2021 at 14:55 ¶ #597908
Reply to praxis

Are you familiar with feng shui?
RussellA September 20, 2021 at 15:15 ¶ #597912
Quoting Tom Storm
Does a work not provide the observer's mind with something to consider?


Yes. Derain in 1905 created the object Estaque which provides the observer's mind with something to consider, thereby allowing the concepts meaning and quality to be applied.

But could an object have either meaning or quality if no-one ever had knowledge of its existence ?
praxis September 20, 2021 at 15:58 ¶ #597923
Reply to frank

Vaguely.
Constance September 20, 2021 at 16:09 ¶ #597925
Quoting frank
I agree, but would add that art usually has a frame around it, or a museum to hold it, a display case over it, etc. Something to hand it forward for the consideration of the audience.

You can put your own invisible frame around the lines on the highway if you like, I suppose, but then it's your own private art.


The way I see it, the pothole in front of my house is a nuisance and an obstacle to my daily affairs. But then, ask me what I think of it from the perspective of art, and I will say, hmmm, let me see, the curvature of the line meets the dark middle, suggestive of mystery, and the cloudy middle a kind of abstract aquatic whatever.....; whatever. I say this is exactly what happens when we see the Mona Lisa. I know I am in the Louvre, I know Devinci painted it, and it is art, so I am there to assess what is before me AS art. But make a print of it. put it on a rug where I feet are wiped and we forget it's art. It's a rug. An intruder enters the house and I grab the rug an assault him.
The "artwork" lies in taking something AS art.
Constance September 20, 2021 at 16:30 ¶ #597930
Quoting Pop
In systems theory what is always there - what is common to all systems, is self organization.
In information theory, it is information that self organizes. In Yogic logic this self organizing element present in everything is consciousness.

I have said art work is information about an artists consciousness, and I have defined consciousness as an evolving process of self organization. So art work is an expression of the artists evolving process of self organization. This IS the something that is always there. There are no other somethings always there. All the other somethings are variable, and open ended - and continually emerging.

I think we just misunderstand each other rather then disagree. Perhaps disagree on expressive style.


If you want to describe what goes on in in experience as self organizing, you will have further trouble accounting for what this self is that is autonomously at work. Are you treating the self as something that is its own presupposition? I mean, something that the analysis of which does not reveal something more basic because it is already a singular basis for all other things? "Self organizing" is a strong claim, after all, where did the organizing self get is motivations and contents? There is the counterclaim that says this self is a construct and self organizing really has no self at all. And if there is a self, it is not to be identified with all it does.
When I talk about always, already there, in this context, what is meant is that art built out of experience, and an artwork is part and parcel of the structure of experience itself. Dewey's key concept is "consummation". A pragmatist, he defined art in pragmatic terms, so the essential structure of successful problem solving yields aesthetics, cognition, affect, consciousness and everything you can imagine. A self IS a pragmatic construction.
frank September 20, 2021 at 16:49 ¶ #597938
Quoting praxis
Vaguely


There's an idea that the mind follows the chi (if I'm not mangling that). Think of garden design where a poorly planned garden turns the mind away, but one that nurtures the flow of chi invites the mind in to be arrested, or moved.

Surely you're aware of the poor garden, so you're perceiving it. But in another sense, you aren't seeing it.

Feng shui is kind of like the frame around the painting (that I mentioned before), the museum around the art., that points to this experience of being invited in to truly see.



praxis September 20, 2021 at 16:59 ¶ #597939
Quoting frank
Surely you're aware of the poor garden, so you're perceiving it. But in another sense, you aren't seeing it.


I don't know what you mean.
frank September 20, 2021 at 17:02 ¶ #597940
Quoting praxis
don't know what you mean.


That's odd. I would have expected you to.
praxis September 20, 2021 at 17:46 ¶ #597948
Reply to frank

So I experience the poor garden. In the most basic sense it could be said that I'm aware of the garden, and that I'm aware of how I feel about the poor garden experience. It is not an aesthetic experience though it could be under different circumstances or if it were 'framed' propely for someone with my sensibilities, I suppose.

I did a bit of reading on Dewey just now since our new friend Constance is apparently incapable of relating Dewey's ideas well. I copied this bit from Stanford.edu:

From a Deweyan viewpoint, aesthetic experience, then, has roughly the following structure. The experience is set off by some factors, such as opening a book, directing a first glance at a painting, beginning to listen to a piece of music, entering a natural environment or a building, or beginning a meal or a conversation. As aesthetic experience is temporal, the material of the experience does not remain unchanged, but the elements initiating the experience, like reading the first lines of a book or hearing the first chord of a symphony, merge into new ones as the experience proceeds and complex relationships are formed between its past and newer phases. When these different parts form a distinctive kind of orderly developing unity that stands out from the general experiential stream of our lives, the experience in question is aesthetic.


Are you saying that by failing to experience the world aesthetically we are, in a sense, not fully experiencing it?
frank September 20, 2021 at 18:08 ¶ #597955
Quoting praxis
Are you saying that by failing to experience the world aesthetically we are, in a sense, not fully experiencing it?


I'm not getting how Dewey's "aesthetic experience" is different from experience in general.

What other kinds of experience are there?
praxis September 20, 2021 at 18:14 ¶ #597957
Reply to frank

You've never had an aesthetic experience?
frank September 20, 2021 at 18:26 ¶ #597960
Quoting praxis
You've never had an aesthetic experience?


Maybe I have? I'm just not familiar with terminology.
Pop September 20, 2021 at 19:11 ¶ #597979
Quoting RussellA
Summary
For both postmodernism and modernism, as the meaning of any artwork resides in the mind of the artist or observer and not the artwork, and as quality is a mental concept, then the quality of the artwork resides not in the artwork but in the mind of the artist, or observer


:up: Very well put.
Tom Storm September 20, 2021 at 19:55 ¶ #597987
Quoting RussellA
But could an object have either meaning or quality if no-one ever had knowledge of its existence ?


Isn't that just a variation of the old - 'Does a falling tree make a sound if no one is there to hear it?'

Quoting RussellA
Yes. Derain in 1905 created the object Estaque which provides the observer's mind with something to consider, thereby allowing the concepts meaning and quality to be applied.


I would have thought that all art effects people's minds when they consider it. There has to be something for the mind to reconstruct.
Pop September 20, 2021 at 20:02 ¶ #597990
Quoting Constance
If you want to describe what goes on in in experience as self organizing, you will have further trouble accounting for what this self is that is autonomously at work. Are you treating the self as something that is its own presupposition?



How is a "self" different to one's consciousness? If art is an expression of consciousness, then art is also an expression of self. Art work is information about the artist's "self".

In systems theory, a self is an artefact of the self organizing process. All natural systems are self organizing, and the result of this organization is the production of a self. A self can be an individual, a group of people like a family, a collective of people - like the characters of this forum - when considered as a whole interactive community, or a really complex system like a an economy. All self organizing systems integrate information much like a black hole, where the information that defines a system becomes more and more dense, such as to distinguish a self.

In information theory ( my personal interpretation ) a "self" is information about the way information has organized itself.

In phenomenology, a self evolves with the experiential process, where cognition disturbs the state of a system, a corresponding emotion is felt, and the system reintegrates. A self aligns itself to meet the consequences of the experience - so is the result of this process, in an endlessly evolving fashion.
Constance September 20, 2021 at 20:51 ¶ #598002
Quoting praxis
To see something aesthetically.

You’ve claimed that the aesthetic is an integral part of experience itself, however, which seems to mean that we always view things aesthetically. Clearly that is not the case, so once again I’m asking what you mean by that claim.


But the idea is that to perceive at all is inherently aesthetic. to put this pencil to use or operate a forklift is aesthetic in that the applied skills are motivated, interesting, valuable, and so on. Speech itself is all of this, so when I speak, I confirm an idea and this is not exclusively a cognitive matter. It is real, a meaningful, the taking up of something that was learned, and in the learning, a thing of value. Dewey held that as we live and breathe, we experience the world aesthetically, AS art, if you will.

Quoting praxis
None of that explains how “the aesthetic is an integral part of experience itself.” In the etymology of the word aesthetic, it at first only meant perception. Maybe you mean it like that? Perception is an integral part experience.


I do qualifiedly follow Dewey: To find the essence of art, one must examine experience. But since experience is an entangled affair, not given to us in parts, but as a whole, with cognition and affect, we analytically dismiss the arational parts, and miss that to do logic or math is to care about doing his, to be engaged fully interested.
Tom Storm September 20, 2021 at 21:06 ¶ #598005
Reply to Constance All you are saying is fairly interesting but what does it bring us in real terms? So we have yet more theory about art - a subject that virtually hemorrhages theory. What do we do with it?
Pop September 20, 2021 at 21:07 ¶ #598006
Quoting Constance
But the idea is that to perceive at all is inherently aesthetic


Yes, to perceive is inherently experiential, so emotional - has feeling and quality. This begs the question how are aesthetics relevant to art exclusively? The answer is that they are not. This would be a confusion of what art is about. Art is about mind meeting mind, but in this process information of various kinds can be entangled into the form of the artwork, including aesthetic information, but this is just one of the many different forms of information that can be entangled in art. Revolution can also be entangled into it. Really, it is as flexible as any form of communication.

Artist's generally speak of the style of their work as a language.

Art is about mind meeting mind, so an expression of consciousness.
Tom Storm September 20, 2021 at 21:11 ¶ #598007
Quoting Pop
Art is about mind meeting mind, so an expression of consciousness.


And then what? What does this insight provide us with?
frank September 20, 2021 at 21:29 ¶ #598010
Quoting Pop
Art is about mind meeting mind, so an expression of consciousness.


I really don't think this is true. It's more like an artist's work is like a seed. Something grows from that seed in the viewer or listener.
Tom Storm September 20, 2021 at 21:40 ¶ #598011
Quoting frank
I really don't think this is true. It's more like an artist's work is like a seed. Something grows from that seed in the viewer or listener.


The problem for me is that this fact is not unique to art, it describes almost anything you care to experience. Seems to me there's no difference between looking at a tree in the twilight and looking at the Mona Lisa.
Tom Storm September 20, 2021 at 21:42 ¶ #598013
Quoting Pop
Art is about mind meeting mind, so an expression of consciousness.


But doesn't this also describe any experience humans have, art being just one of an endless possibility? It doesn't help us understand art in any way as you could use this lens to view even a basic conversation between people.
Pop September 20, 2021 at 21:55 ¶ #598016
Quoting Tom Storm
But doesn't this also describe any experience humans have,


Yes, it is no different really. The only difference is that the artist is not there. What is there is something that represents him / her - entangled into the form of an evolving idiomatic ungrounded variable mental construct called art.

When you create art you are giving me information about your consciousness, and subconsciousness. You tell me how you understand art by showing me what you use it for. You give me an insight into your intelligence, your intent, your sympathies, your talent, your demographic, your politics, your spiritual beliefs, etc, etc. A whole bunch of information which I have to interpret with my consciousness, just like a conversation on TPF.

**You could say art is symbolic of the self that created it, but really it is symbolic of self organization - which is much the same thing.
Pop September 20, 2021 at 22:03 ¶ #598021
Quoting frank
I really don't think this is true. It's more like an artist's work is like a seed. Something grows from that seed in the viewer or listener.


Possibly there is an element of that going on, but this would not negate the view that it is a meeting of minds?
frank September 20, 2021 at 22:33 ¶ #598029
Quoting Pop
Possibly there is an element of that going on, but this would not negate the view that it is a meeting of minds?


Maybe there's some degree of meeting.
frank September 20, 2021 at 22:36 ¶ #598031
Quoting Tom Storm
The problem for me is that this fact is not unique to art, it describes almost anything you care to experience. Seems to me there's no difference between looking at a tree in the twilight and looking at the Mona Lisa.


Yes. I don't think there's really one all-purpose definition of art.

The value in debating it is that it leads me to think through my ideas about it, with something to contrast my ideas with, and someone to bounce ideas off of. :grin:
Tom Storm September 20, 2021 at 23:06 ¶ #598044
Quoting Pop
You give me an insight into your intelligence, your intent, your sympathies, your talent, your demographic, your politics, your spiritual beliefs, etc, etc. A whole bunch of information which I have to interpret with my consciousness, just like a conversation on TPF.


I'm partly in sympathy with this except that a genuine conversation has more clarity and is an exchange and we can ask for clarifications - art is often deliberately irrational and symbolic and hard to discern. Also, artists can notoriously disguise their true selves behind a wall of craft.



T_Clark September 20, 2021 at 23:36 ¶ #598064
Quoting praxis
Cool to hear someone describe it this way, as being creative is so commonly only associated with the arTIST.


Quoting Tom Storm
I often find myself making a distinction between craft and art. Is a pair of exquisite, hand made shoes an example of art or craft? I tend to go with the latter, because the experience isn't just aesthetic, but must also be practical and be located in a lineage of other such traditional artifacts. Is a great and talented chef an artist or a craftsperson? We often throw the word 'artist' around as a type of free-range compliment - the barista down the road from me is called an artist by people in our office, etc.


I wanted to respond to this since praxis' post was in response to mine. I remember in an earlier thread about art, I waxed rhapsodic about the passion I feel for writing technical specifications for earthwork construction projects. I don't know if you've ever read any Tech Specs, as we call them. They are the driest, pared down, compact descriptions of the work to be performed you can imagine. And they are very important. A bad set of specs leads not only to an improperly constructed project, but also to claims and lawsuits. A good set, in the hands of our intrepid engineer, provides a legally enforceable guide to what is expected from the contractor. I love them. I love writing them. I love going out into the field and discovering the mistakes I made.

Not to overstate things, but my mind and all my creativity go into writing Tech Specs and preparing Drawings for these projects. Don't you think that all Einstein's intellect, imagination, and creativity went into his 1905 relativity paper? Darwin? There you go. Me, Einstein, and Darwin in the same paragraph.

I have written poetry. It's something I enjoy once in a very long while. Writing poems is not the same thing as writing Tech Specs. It feels like it comes from a different place in me. Civil engineering, in general, is not art. I guess not craft either...I don't think physics or evolutionary biology are either art or craft. I guess my conclusion is that what makes art art is not creativity or imagination. It's something else.
Pop September 20, 2021 at 23:55 ¶ #598080
Quoting Tom Storm
I'm partly in sympathy with this except that a genuine conversation has more clarity and is an exchange and we can ask for clarifications - art is often deliberately irrational and symbolic and hard to discern. Also, artists can notoriously disguise their true selves behind a wall of craft.


Yes, it is not at all clear cut, but roughly it provides such information, imo. Art symbolizes a certain attitude, or mindset, or understanding, and If I agree with the understanding symbolized then it is something that I would consider hanging on my wall. Likewise Rap symbolizes a certain cultural view, but it is not one I can warm to, so I do not listen to it.
ArisTootelEs September 21, 2021 at 00:01 ¶ #598083
Reply to Pop

I think your definition is false. If you mean people by "a consciousness, than the people have ideas and emotions, thoughts and pain, suffering and humor, orsay a religious experience. The can express these. You can translate them in information and consciousnesses experiencing them but what does this add? It only sattisfies your own will or wanting to integrate all of it. But integrating is the opposite of differentiating. Like you define it, art becomes empty and meaningless. Just some vague idea about information, self-organising structures, and "consciencenesses" (why don't you say "people"?) is introduced. I'm sorry to say but your definition is inhuman.
Tom Storm September 21, 2021 at 00:15 ¶ #598099
Quoting Pop
Likewise Rap symbolizes a certain cultural view, but it is not one I can warm to, so I do not listen to it.


Yep. So in the end we're back to that old fashioned notion of personal taste.

ArisTootelEs September 21, 2021 at 00:25 ¶ #598101
Quoting Pop
Likewise Rap symbolizes a certain cultural view, but it is not one I can warm to, so I do not listen to it.


What do you mean by symbolizing a cultural view? Rapping against authority on cool music? And hot words, in the case of true rap. On flowing rhyme.
Pop September 21, 2021 at 00:27 ¶ #598102
Quoting ArisTootelEs
Like you define it, art becomes empty and meaningless. Just some vague idea about information, self-organising structures, and "consciencenesses" (why don't you say "people"?) is introduced. I'm sorry to say but your definition is inhuman.


I think art is confused and often meaningless in its current state, and was recently well symbolized by a banana nailed to a wall. Whether you like the definition or not, it is what is always present in art, so is the only way to define art. Art can be defined, but only to this extent, and not to everybody's satisfaction.
ArisTootelEs September 21, 2021 at 00:28 ¶ #598103
Reply to Pop

Elementary particles are present in ALL art too...
ArisTootelEs September 21, 2021 at 00:34 ¶ #598106
Quoting Pop
Whether you like the definition or not, it is what is always present in art, so is the only way to define art.


Beside that I don't like it, it is factually wrong.

Pop September 21, 2021 at 00:39 ¶ #598108
Quoting Tom Storm
Yep. So in the end we're back to that old fashioned notion of personal taste.


But now we know what that means?

Pop September 21, 2021 at 00:41 ¶ #598109
Quoting ArisTootelEs
Besides that I don't like it, it is factually wrong.


:roll: How?
ArisTootelEs September 21, 2021 at 00:42 ¶ #598111
Reply to Pop

I don't wanna destroy your dream... :lol:
Tom Storm September 21, 2021 at 00:50 ¶ #598119
Quoting Pop
Yep. So in the end we're back to that old fashioned notion of personal taste.
— Tom Storm

But now we know what that means?


We've never not known. :wink:
praxis September 21, 2021 at 01:43 ¶ #598153
Quoting Constance
Dewey held that as we live and breathe, we experience the world aesthetically, AS art, if you will.


That is obviously not true, and Dewey doesn’t hold to this. I spent a few minutes reading about Dewey this morning and he appears to claim that there’s always the potential for aesthetic experience. It is plain silly to say that we always experience the world this way.

I can’t tell if you’re having language trouble, or understanding Dewey trouble, or just goofing.
T_Clark September 21, 2021 at 01:47 ¶ #598159
Reply to ArisTootelEs

Hey, Marco, get lost.
RussellA September 21, 2021 at 13:59 ¶ #598367
Every observed object has aesthetic value - but not all aesthetic values are equal
If the aesthetic is understood as Hutcheson's "compound ratio of Uniformity and Variety", then every observed object has an aesthetic, and every observed object is an artwork. An observed object could be Derain's Bridge over the Riou or the Golden Gate Bridge. (y) @Constance

From the fact that every object has a temperature, it does not follow that all objects have the same temperature. The Mercedes AMG F1 W12 E Performance and the Skoda 1100 R are both cars, but it does not follow that they are the same. Warhol's Brillo Box and Rembrandt's Self Portrait are both artworks and both have an aesthetic, but it does not necessarily follow that they have the same artistic and aesthetic quality.

As the aesthetic experience originates in the observer and not the observed object, the aesthetic experience is subjective rather than objective, and it follows that there cannot be an absolute measure of aesthetic value. But even so, there may be general agreement between different observer's as to the aesthetic value of a particular object.

IE, even though every observed object has an aesthetic value, some observed objects have a greater aesthetic value than others.

Of what use is the aesthetic
One could ask of what practical use is Kirchner's Alpleben. It just sits on the wall doing nothing. At least with a car I can get from A to B, and at least with an oven I can cook evening dinner. The Kirchner gives me nothing practical, and yet for me the aesthetic value of the kirchner outweighs anything that is mundanely practical.

As the aesthetic experience is a qualia (apologies to Banno - although it is a useful word), in the same way as the pain of a headache, the taste of wine or the redness of an evening sky, it is a Kantian a priori intuition, and therefore beyond being able to be described.

As the value of tasting red wine is in the experience itself, the value of the aesthetic is in the experience itself.

Aesthetic intuition doesn't give specific knowledge, but it does point to the possibility of discovering greater knowledge. An aesthetic of "Uniformity and Variety" gives the promise of being able to to discover and understand patterns within a seemingly chaotic mass of unconnected information. The experience of the aesthetic points to the conscious organisation of seemingly chaotic information into comprehensible patterns. (y) @Pop

The engineer who designs a bridge and the child that makes a car of lego are both using their imagination and understanding in creative acts, though only the child's parents or the postmodernist would say that their creations have the same value. A Rembrandt Self-Portrait and a Warhol Brillo Box both have artistic and aesthetic value, but their artistic and aesthetic values are not comparable. It is better to strive for the sophistication of a Rembrandt than a simpleness of a Warhol.

IE, the aesthetic experience points to the possibility of discovering the "Uniformity" of patterns within a "Variety" of information.

Summary
Every observed object is an artwork and has an aesthetic, but the aesthetic value of some artworks is higher than others.
praxis September 21, 2021 at 16:03 ¶ #598386
Quoting RussellA
Summary
Every observed object is an artwork and has an aesthetic, but the aesthetic value of some artworks is higher than others.


This is like saying that all people are sexy and some are just sexier than others. The fact of the matter is that we don’t always view others in terms of sexuality. When you’re in the presence of your mother are you always appreciating her sexuality, for example?

Also, you say the aesthetic value of some artworks is higher than others, but also say “the aesthetic experience is subjective rather than objective” and “there may be general agreement between different observer's as to the aesthetic value of a particular object.” I think this indicates a few important points:

  • Failure to have an aesthetic experience rests entirely on the individual.
  • Individual aesthetic experience is constrained by culture.
  • Some individuals are more constrained by their culture/society than others.


Why the fuck would anyone want to constrain their aesthetic experience? In a word, because they’re insecure.
RussellA September 21, 2021 at 16:45 ¶ #598397
Quoting praxis
aesthetic value


You are right. Similarly, when I am in the presence of any object, even though all objects have a temperature, I am not always appreciating that object's temperature.
T_Clark September 21, 2021 at 17:04 ¶ #598408
Reply to Tom Storm

I haven't been keeping up to date with this thread because I was gone for the weekend. Reading through the posts now, I see you've been doing a good job standing up for a down-to-earth understanding of art. My opinions match yours pretty well, but I don't know if I could have spoken for them as well as you have.
Constance September 21, 2021 at 17:25 ¶ #598417
Quoting Pop
How is a "self" different to one's consciousness? If art is an expression of consciousness, then art is also an expression of self. Art work is information about the artist's "self".

In systems theory, a self is an artefact of the self organizing process. All natural systems are self organizing, and the result of this organization is the production of a self. A self can be an individual, a group of people like a family, a collective of people - like the characters of this forum - when considered as a whole interactive community, or a really complex system like a an economy. All self organizing systems integrate information much like a black hole, where the information that defines a system becomes more and more dense, such as to distinguish a self.

In information theory ( my personal interpretation ) a "self" is information about the way information has organized itself.

In phenomenology, a self evolves with the experiential process, where cognition disturbs the state of a system, a corresponding emotion is felt, and the system reintegrates. A self aligns itself to meet the consequences of the experience - so is the result of this process, in an endlessly evolving fashion.


First, this sounds like some kind of information take on Hegelian phenomenology. Disturbance? Is this meant to be the negation, while reintegration is the synthesis? This is not, of course, at all what Hegel had in mind.
But really, this about the self is just a marginal point. The real point is your lack of a clear idea of what art is when your whole intention is give a definition of art. You can't say you are aligned with Dewey if you don't think the aesthetic is a concept that figures significantly into this since Dewey's consummatory experience is inherently aesthetic (as it is cognitive. But this is not to say of art that analysis does not have the aesthetic feature as its definitional aspect. Analysis talks like this because its job is to examine the whole and find its parts. Even if it is assumed that the parts as analytically considered are abstractions from the original whole. Dewey holds the aesthetic to be the essence of art. It is the consummatory affect of problem solved, which is taken up and amplified by the artist.
Rstotalloss September 21, 2021 at 17:42 ¶ #598423
I'm not sure if aesthetics is a very important to the arts. Sometimes it is, sometimes not. Artificial and art can be closely related. Is a bridge art? Is it art when a dam is made by beavers? Is a dam artificial, arty? Antisjock? Why not. Plastic is artificial. Graphene is too. Are these artificial materials art? Ars longa vitae brevis. Is that why we make art? No, for christsake! Of course it follows but don't we like to share as well as we want to absorb the other's art? We experience inner worlds and outer worlds. We are in the middle. We wanna express our visions. Like the native Australian expresses the dreamworld the western physicist expressez the standard model and beyond. The beyondness being the most interesting.
praxis September 21, 2021 at 18:07 ¶ #598435
Quoting RussellA
when I am in the presence of any object, even though all objects have a temperature, I am not always appreciating that object's temperature.


This is a very poor simile because temperature is a physical fact and in that way objective. Under the same conditions, anyone can measure the temperature of an object and it will be the same, though we may subjectively experience the temperature of the object differently relative to our own temperature.

So it's like you're saying that all things have a factually objective aesthetic value in the same way that an object has a factually objective temperature. If that's what you believe, do you also believe that all things have a factually objective moral value?

I would guess that our aesthetic sense is determined by natural aesthetic intuition, culture, and our own individual development.

What may induce an aesthetic experience in one individual may inexplicably cause a panic attack in another. If you've ever had a panic attack you would know just how unaesthetic an experience it can be.
Constance September 21, 2021 at 18:59 ¶ #598457
Quoting praxis
None of that explains how “the aesthetic is an integral part of experience itself.” In the etymology of the word aesthetic, it at first only meant perception. Maybe you mean it like that? Perception is an integral part experience.


Well, as with all things, if you want to get to an understanding at the level of basic questions, you have to ask, what is it that is there, in our midst that gives rise to whatever there is that wants examining? The solid basis of the thing that people are theorizing about. In art, what is it that a thing has that without it, it would no longer be art? We find that an examination of physical features will not do; it's not like asking what a violin is, say, which is easy because the observable features are so clear (though ambiguity can arise when these features are distorted, extended, whatever). All observable things and their features can be art.
Then it has to be something universal if all things can be that, and universality looks not to the particular object, but what is in being an object as such. Kant did this with reason, looking not at this example or that, but judgment itself, and this goes to the structure of experience itself. Here, it is the same: art is not some special feature, or assembly of features, but something we bring into the object as an object, Something, already there, in the structure of experience itself.

See Dewey. But Dewey fails to understand the aesthetic. This is what is underdetermined, because the aesthetic is as rich and varied as objects can be rich and varied.
Rstotalloss September 21, 2021 at 19:01 ¶ #598459
Quoting praxis
This is a very poor simile because temperature is a physical fact and in that way objective


Physical facts are subjective in the sense that we consider them as facts. All physical phenomena unfold in an objective arena and this arena is constructed by our consciousness.
Constance September 21, 2021 at 19:29 ¶ #598473
From a Deweyan viewpoint, aesthetic experience, then, has roughly the following structure. The experience is set off by some factors, such as opening a book, directing a first glance at a painting, beginning to listen to a piece of music, entering a natural environment or a building, or beginning a meal or a conversation. As aesthetic experience is temporal, the material of the experience does not remain unchanged, but the elements initiating the experience, like reading the first lines of a book or hearing the first chord of a symphony, merge into new ones as the experience proceeds and complex relationships are formed between its past and newer phases. When these different parts form a distinctive kind of orderly developing unity that stands out from the general experiential stream of our lives, the experience in question is aesthetic.


What this describes is the consummatory experience, a "real" experience as opposed to some routine, which is the enemy of the aesthetic. Here it say the developing unity stands out from the general experiential stream of our lives, the distinctive kind has to do with the way the aesthetic naturally occurs in experience in the most fundamental structural feature of pragmatism: problem solving. You have to read Art As Experience for this: see his description of the organism encountering an obstacle, bringing resources to bear, finally solving the issue (whew!), then incorporating the new affair's events into existing resources for future ordeals. This "whew" is the foundation of the aesthetic, as it is of cognition and any and all understanding.
Look especially at the temporal nature of the aesthetic experience: pragmatics is a forward looking theory, and the outcome is the meaning yielded. What is nitroglycerin? It is: IF it is thrown at such and such a velocity and impacts with such and such force, THEN there will be a release of energy on impact, etc. etc. That is what nitro IS. There IS of a thing is bound up with the event, and the successful execution both gives us cognitive meaning, what the understanding really understands is the result, as well as the aesthetic, the ????????? For the aesthetic's "what IS it" is also bound up with the event, and events do not tell us what such things are, like affect, or taste, touch and the rest. They only tell us what will happen under certain conditions.
Dewey has been criticized: when a boxer smashes his fist into his opponent's face, is THIS aesthetic? But then, this may be the real strength of this theory, because art is, after all, everything, or IN everything, for all things are events. One has to put aside the impossible ontology of presence, just like Heidegger said.
So anyway, take reading the first lines of a book: what is there? anticipation with possibilities. The writer strives for the aesthetic of literature, and as with all art, the aesthetic is "wrought out" of the work done. Here, it would be constructing a narrative of human affairs with tensions, ambiguities, and ironies and so forth, which would all play out and resolve in, you guessed it, the consummatory denouement!
Note how narratives that don't have this, but keep the reader in unresolved conflict, are inherently unsettling, the anti-aesthetic: IS THIS art? Dewey would call it anti art, I would think. Interesting to consider.
praxis September 21, 2021 at 19:30 ¶ #598474
Quoting Constance
... art is not some special feature, or assembly of features, but something we bring into the object as an object, Something, already there, in the structure of experience itself.


You're making the same fundamental assumption as RussellA, that inherent value exists in all things, which I suppose is some form of idealism.

Quoting Constance
All observable things and their features can be art.


All observable things and their features can be seen as good, or be seen as bad. It depends on what our motivation or purpose is, amongst other factors. Guns can protect us, so they're good. :up: Guns can harm us, so they're bad. :down: There's no "already there" structure in the universe that makes guns only good or only bad.

Constance September 21, 2021 at 19:38 ¶ #598477
Quoting praxis
... art is not some special feature, or assembly of features, but something we bring into the object as an object, Something, already there, in the structure of experience itself.
— Constance

You're making the same fundamental assumption as RussellA, that inherent value exists in all things, which I suppose is some form of idealism.

All observable things and their features can be art.
— Constance

All observable things and their features can be seen as good, or be seen as bad. It depends on what our motivation or purpose is, amongst other factors. Guns can protect us, so they're good. :up: Guns can harm us so they're bad. :down: There's no "already there" structure in the universe that makes guns only good or only bad.


So first, see what I wrote just above this posting. I pretty well know Dewey, though he is not the be all and end all for me at all.
Idealism? Is Dewey an idealist? Tricky question. Is Wittgenstein? Another.
The "already there" part of this is rather strong for art. It is Dewey exactly, and I mean it is THE central thesis in his Art As Experience. And it works well because art, the aesthetic are entirely open questions, and they are open because experience itself is open. If the aesthetic is what issues from consummatory experiences, then what it is is going lie in an analysis of this experience, and this is a very entangled affair. Art is difficult to define because of this entanglement, and this is an issue that parallels ethics.
Constance September 21, 2021 at 19:42 ¶ #598478
Quoting praxis
There's no "already there" structure in the universe that makes guns only good or only bad.


The good and the bad is not about guns, but about the bad or good that is embedded in experience. Before guns get our attention as being good or bad, there has to be an experiential foundation of this for the discussion to make any sense. THIS is where phenomenology finds it place, at the foundation fo the given of the world that is always, already there prior to any specifics coming under review.
Tom Storm September 21, 2021 at 19:43 ¶ #598479
praxis September 21, 2021 at 19:53 ¶ #598481
Quoting Constance
The good and the bad is not about guns, but about the bad or good that is embedded in experience.


Right, you appear to be claiming that aesthetic experience or art is embedded in experience, which is like saying that 'good' is embedded in experience. It's like saying that everything from gummy bears to guns IS inherently good, and it's just that in some circumstances we don't realize that they're good.

People who make claims like this are motivated by a desire to control the views of others, so that they can be perceived as an authority. Creepy as fuck but all too common.
Constance September 21, 2021 at 20:12 ¶ #598485
Quoting praxis
Right, you appear to be claiming that aesthetic experience or art is embedded in experience, which is like saying that 'good' is embedded in experience. It's like saying that everything from gummy bears to guns IS inherently good, and it's just that in some circumstances we don't realize that they're good.


Look at this phenomenologically. Take a simply matter: the gummy bears. How can gummy bears be taken up ethically at all? There has to be some original value that is at stake. Someone must want them, love them, or hate them, is revolted by them. If something of this kind is not there, then no ethical problem can possibly arise. Such "value" makes ethics possible. It is the entanglements in nonvaluative affairs, i.e., factual affairs, that make ethics problematic in ordinary experiences.Value is art is exactly the same. Art's value lies in this foundational, phenomenological "presence" the many yums and ughs of the world. Phenomenologically: take the glee Hitler experienced as he gassed Jews. His glee is as a value experience is unassailable. It is simply a fact that he experienced this glee, say, and by itself, phenomenologically, that is, it is Good. What makes it bad is the context.
One cannot deny the phenomenologically given and its manifest properties, and it is here, at this primordial presentation that we find the essence of ethics and aesthetics. This essential concrete goodness and badness is in experience itself, and it is what is in play when judgments are made. Again, judgment is a very, very entangled business, not one denies this. But to go to art's and ethics' essence is reductive to the phenomenon.
praxis September 21, 2021 at 20:46 ¶ #598492
Quoting Constance
It is simply a fact that he experienced this glee, say, and by itself, phenomenologically, that is, it is Good. What makes it bad is the context.


This is nonsensical. You cannot have an out-of-context experience.
Pop September 21, 2021 at 20:59 ¶ #598495
Quoting Constance
The real point is your lack of a clear idea of what art is when your whole intention is give a definition of art.


I define it to the extent that it can be defined, in the terms that can define it. It is not possible to define art in terms of aesthetics as they are endlessly variable and open ended- aesthetics will continue to evolve in line with human consciousness.

Also as @RussellA has pointed out aesthetics do not reside in the art work itself, but in the interaction
of art work and observer - they are the result of this experience. You can not define this experience - ever. True it always exists, but it does nor exist in any constant way. Hence art that is beautiful to one person, can be ugly to the next. What is a urinal in one era, is great art in the next.

The thing that everybody is missing is that a definition of art requires the identification of an attribute that is constantly present in art. There is only one thing constantly present in art, and everything else is variable, and optionally present. The constant is the mind activity expressed in the form of the art.
That is it! that is all that is constantly present. As we analyze this mind activity, we find it is to do with self organization - the artist makes art in the course of life, and the art reveals their attitude to life in it's form, broadly speaking.

The artist is free to make anything into art, but makes a choice in the context of a larger scene evolving around them, this choice reveals their consciousness. In the midst of a war, if I paint flowers, such a choice says something about me. It reveals where my head is at. A similar such situation always exists, and an artist makes choices about art within this larger evolving context. The choices they make reveals where their heads are at, what is their consciousness, and how they self organize.

Quoting Constance
Dewey holds the aesthetic to be the essence of art.


Quoting Tom Storm
"Art is not the possession of the few who are recognized writers, painters, musicians; it is the authentic expression of any and all individuality. Those who have the gift of creative expression in unusually large measure disclose the meaning of the individuality of others to those others. In participating in the work of art, they become artists in their activity. They learn to know and honor individuality in whatever form it appears. The fountains of creative activity are discovered and released. The free individuality which is the source of art is also the final source of creative development in time." Time and Individuality


Seems to me Dewey is saying "Free individuality" is the essence of art, which aligns with my view that it is consciousness, and more specifically self organization.
Tom Storm September 21, 2021 at 21:14 ¶ #598501
Quoting Pop
Seems to me Dewey is saying "Free individuality" is the essence of art, which aligns with my view that it is consciousness, and more specifically self organization.


I didn't really understand what Dewey meant but I thought it was an interesting perspective given your angle.

You seem to keep shoehorning consciousness into anything before you.

You still haven't explained (as far as I can tell) why consciousness matters here? If art is consciousness and self-organization, then what? Isn't everything? Taking a shit is consciousness and self-organization and so is Rembrandt's The Night Watch - reconcile the two for us? How does this possibly assist us in gaining any clarity about art?
praxis September 21, 2021 at 21:27 ¶ #598505
Quoting Pop
The constant is the mind activity expressed in the form of the art.


Mind activity is expressed in everything we do, so you must mean a specific kind of activity. Let's call it 'neural art activity' or NAA for convenience. Now if I were to buy a paint-by-numbers kit and I followed it to the letter, would the resulting painting be an artwork? To others, it could certainly be regarded as artwork because it looks like artwork.

You might say that the NAA came from the people who designed the paint-by-numbers kit, but they might have simply used a photograph and a computer algorithm to produce it, and their efforts were solely for the purpose of producing paint-by-number kits and making a profit.

You need a theory that can distinguish things like fine art, commercial art, design, decoration, etc.
Pop September 21, 2021 at 21:37 ¶ #598513
Quoting Tom Storm
You still haven't explained (as far as I can tell) why consciousness matters here? If art is consciousness and self-organization, then what? Isn't everything? Taking a shit is consciousness and self-organization and so is Rembrandt's The Night Watch - reconcile the two for us? How does this possibly assist us in gaining any clarity about art?


Quoting Pop
The thing that everybody is missing is that a definition of art requires the identification of an attribute that is constantly present in art. There is only one thing constantly present in art, and everything else is variable, and optionally present. The constant is the mind activity expressed in the form of the art.
That is it! that is all that is constantly present. As we analyze this mind activity, we find it is to do with self organization - the artist makes art in the course of life, and the art reveals their attitude to life in it's form, broadly speaking.


Platoon September 21, 2021 at 21:51 ¶ #598519


It doesn'tQuoting Tom Storm
You still haven't explained (as far as I can tell) why consciousness matters here? If art is consciousness and self-organization, then what? Isn't everything? Taking a shit is consciousness and self-organization and so is Rembrandt's The Night Watch - reconcile the two for us? How does this possibly assist us in gaining any clarity about art


To answer your question: it doesn't. It merely translates art into a (alleged or proposed) universal language of self-organisation, consciousnesses (which are just people) and their "interaction".

Pop September 21, 2021 at 21:51 ¶ #598520
Quoting praxis
Mind activity is expressed in everything we do, so you must mean a specific kind of activity. Let's call it 'neural art activity' or NAA for convenience. Now if I were to buy a paint-by-numbers kit and I followed it to the letter, would the resulting painting be an artwork? To others, it could certainly be regarded as artwork because it looks like artwork


An artist is free to choose the form of their art, including paint by numbers ( which I think has been done ) but the choice they make reveals their person - it reveals where their heads are at, so expresses their consciousness. It expresses how they think, what they have been influenced by, their attitudes to life - it expresses how information they have been shaped by has formed them - they in turn re-present this information in the form of their art.

Quoting praxis
You might say that the NAA came from the people who designed the paint-by-numbers kit, but they might have simply used a photograph and a computer algorithm to produce it, and their efforts were solely for the purpose of producing paint-by-number kits and making a profit.


Understanding the background - the context that the art is made in is important to understanding the art. In the instance you bring up, you understand the artist needs to make a buck, and so the work should be viewed in this light. The art is still information about the artists self organization?
Tom Storm September 21, 2021 at 22:04 ¶ #598523
Quoting praxis
You need a theory that can distinguish things like fine art, commercial art, design, decoration, etc.


Can consciousness and self-organization rightly be called a theory? It seems a bit slender to me.
DMcpearson September 21, 2021 at 22:18 ¶ #598529
Quoting Tom Storm
Can consciousness and self-organization rightly be called a theory? It seems a bit slender to me.


It is. Offers ziltch to the discussion about art.
praxis September 21, 2021 at 22:43 ¶ #598541
Quoting Pop
An artist is free to choose the form of their art, including paint by numbers (which I think has been done) but the choice they make reveals their person - it reveals where their heads are at, so expresses their consciousness. It expresses how they think, what they have been influenced by, their attitudes to life - it expresses how information they have been shaped by has formed them - they in turn re-present this information in the form of their art.


Obviously, a painting done yourself reveals a lot more about a person than a painting done from a paint-by-numbers kit. A dozen people could do the same kit and all the resulting paintings would be rather indistinguishable. And yet any of those dozen could hang their picture on the wall and call it art, and it is art, merely because they've presented it as such. If anyone disagrees and can't see it that way it is their own failing, their own refusal or inability to accept the invitation to an aesthetic experience.

Original artwork can express a lot about a person, including their skill at expressing themselves.

Quoting Pop
Understanding the background - the context that the art is made in is important to understanding the art. In the instance you bring up, you understand the artist needs to make a buck, and so the work should be viewed in this light. The art is still information about the artists self organization?


Not necessarily, no. In commercial art, the intention is to express the values of the client in a way that will resonate with a particular audience, for the purpose of making money.


Jeunesocrate September 22, 2021 at 00:04 ¶ #598570
If I shit I'm conscious of the big self-organized saucage coming from my but. A true piece of art proudly made by yours truly. Everything that self-organizes and of which we are conscious is art like this. But it isn't.
Constance September 22, 2021 at 00:33 ¶ #598580
Quoting Tom Storm
You still haven't explained (as far as I can tell) why consciousness matters here? If art is consciousness and self-organization, then what? Isn't everything? Taking a shit is consciousness and self-organization and so is Rembrandt's The Night Watch - reconcile the two for us?


But then, and your example is especially telling because it sets itself apart from anything we want to cll art; I mean, shitting and Bach, together in the same category?
But this is why Dewey's thinking is strong here: Art is no longer "the beautiful" in the modern thinking. Now,maybe it should be, but the art world has a different take. It allows shit to be art, literally. It allows the artist's prestige to drive the value of an artwork. So, part of the the trouble lies in the promiscuous inclusion, and here it is just people and the concept of art in the artworld, and "art" is simply tossed around arbitrarily, giving us this intractable idea of art and trying to endlessly redefine it. Maybe we should tell the the artworld to F*** off, and just because it was Picasso who rearranged a bicycle wheel and handle bars to look like a bull does not establish a new paradigm of what art can be, Duchamp notwithstanding.
Maybe Dewey is closer to being right than the artworld's aimless mission to make money through the critic's valorations of bullsh*t. Because Dewey believes in the aesthetic as something concrete, produced IN experience and grounded in something substantive.
Tom Storm September 22, 2021 at 00:52 ¶ #598588
Quoting Constance
But then, and your example is especially telling because it sets itself apart from anything we want to cll art; I mean, shitting and Bach, together in the same category?


Cool. Yep - both are examples of consciousness and self-organization - which is why I said these criteria are close to meaningless.

Quoting Constance
Art is no longer "the beautiful"


Unless one is a slave to idealism notions of 'the beautiful' are not central to art.

Quoting Constance
Maybe we should tell the the artworld to F*** off, and just because it was Picasso who rearranged a bicycle wheel and handle bars to look like a bull does not establish a new paradigm of what art can be, Duchamp notwithstanding.


We tend to conflate what is art with what is good art. I am fine with piles of bricks, unmade beds and urinals... it is art if it is put on display as such. But it may not be good art, which is a separate matter entirely.

Quoting Constance
Maybe Dewey is closer to being right than the artworld's aimless mission to make money through the critic's valorations of bullsh*t.


The problem is the market. If making money is involved the process is often diverted/corrupted. I don't think there is an artworld as such. There are artworlds and some of them are dominated by insincere money grubbers and have more dominance - 'Twas always thus.

Agree with much of your sentiment.
Constance September 22, 2021 at 00:55 ¶ #598589
Quoting Pop
Also as RussellA has pointed out aesthetics do not reside in the art work itself, but in the interaction
of art work and observer - they are the result of this experience. You can not define this experience - ever. True it always exists, but it does nor exist in any constant way. Hence art that is beautiful to one person, can be ugly to the next. What is a urinal in one era, is great art in the next.


I am going to take issue with this. What you cannot define is emotion, affect. This is a given, irreducible. But even if we are willing to call the significant aesthetic affect, then we can at least rule out, not that anything can be art, but what it is IN the art that makes it art, which is, as I see it, the point. Shitting can be art, I think Dewey would have to admit, because the act of shitting and the follow through is learned, and as a young child this was a problem to solve, to work through until there was a resolution, and this resolution "wrought out" the ability to follow through with toilet tissue and so on. It is, as all things are, inherently aesthetic, the satisfaction that it was done well, completely. NOT that it is art, because art takes what is basic, like this, and amplifies the aesthetic; but rather, that it is essentially aesthetic. Quoting Pop
The thing that everybody is missing is that a definition of art requires the identification of an attribute that is constantly present in art. There is only one thing constantly present in art, and everything else is variable, and optionally present. The constant is the mind activity expressed in the form of the art.
That is it! that is all that is constantly present. As we analyze this mind activity, we find it is to do with self organization - the artist makes art in the course of life, and the art reveals their attitude to life in it's form, broadly speaking.


No, no. The mind activity is vague. What in the mind activity is aesthetic? Reason simpliciter is not aesthetic. The aesthetic requires the full experience, and it is IN this the aesthetic is allowed to make an appearance. The aesthetic is affect, though this is not to say if one screams in contempt she is making art. It is to say that when one takes up an object AS art, the screaming in contempt can be art.
Constance September 22, 2021 at 00:59 ¶ #598590
Quoting praxis
This is nonsensical. You cannot have an out-of-context experience.


No. The context is taking up a thing apart from others. Kant did this with reason. It is not that Kant thought reason could be conceived independently of context, but that putting selected contexts at bay in order to give analysis to one feature is what analysis is all about.
Pop September 22, 2021 at 01:08 ¶ #598597
Quoting Constance
The aesthetic is affect, though this is not to say if one screams in contempt she is making art. It is to say that when one takes up an object AS art, the screaming in contempt can be art.


Quoting Constance
I am going to take issue with this. What you cannot define is emotion, affect. This is a given, irreducible.


Quoting Pop
The thing that everybody is missing is that a definition of art requires the identification of an attribute that is constantly present in art. There is only one thing constantly present in art, and everything else is variable, and optionally present. The constant is the mind activity expressed in the form of the art.



**The form of the artist's consciousness, creates the form of the art, which effects the form of the observers consciousness, on, and on.
This is how information works - it changes the form of the system it interacts with.
Constance September 22, 2021 at 01:12 ¶ #598598
Quoting Tom Storm
We tend to conflate what is art with what is good art. I am fine with piles of bricks, unmade beds and urinals... it is art if it is put on display as such. But it may not be good art, which is a separate matter entirely.


But what is it you are fine with? I mean, what is it about art that makes it art such that a pile of bricks can be art? This issue presses forth. I say it is affect in art. Take shitting once more. As such, it is not art at all, nor is my pen or my cat. But if we are asked to consider my cat AS art, the context changes altogether. The question that haunts this issue is this "what it is that makes the encounter one of art."
Pop September 22, 2021 at 01:14 ¶ #598600
Quoting praxis
A dozen people could do the same kit and all the resulting paintings would be rather indistinguishable.


Quoting praxis
Original artwork can express a lot about a person, including their skill at expressing themselves.


But wouldn't this situation be an expression of their consciousness rather then aesthetics?

Quoting praxis
Not necessarily, no. In commercial art, the intention is to express the values of the client in a way that will resonate with a particular audience, for the purpose of making money.


Commercial art is still an expression of consciousness, but this time in respect to achieving the aims of the client. It is still an expression of your self organization, in that this is how you have chosen to organize your life
Constance September 22, 2021 at 01:18 ¶ #598601
Quoting Pop
The thing that everybody is missing is that a definition of art requires the identification of an attribute that is constantly present in art. There is only one thing constantly present in art, and everything else is variable, and optionally present. The constant is the mind activity expressed in the form of the art.


But mind activity is nonspecific. What, in the mind activity, is aesthetic? This begs for analysis, for mind activity is like Dewey saying it is all experience. He doesn't do this. He wrote a book about it. So what are you saying it is? Information? Obviously not, for this is more vague than "mind activity".
If you agree with Dewey, then say so, and then show how you improve on Art As Experience's essential claims. But again, Dewey had a specific idea as to what the aesthetic was.
frank September 22, 2021 at 01:21 ¶ #598605
Quoting Constance

I mean, what is it about art that makes it art such that a pile of bricks can be art?


I think this point will make more sense to people who are into conceptual art. "Art" has different meanings depending on context of use, right?
Pop September 22, 2021 at 01:23 ¶ #598606
Quoting Constance
But mind activity is nonspecific


It is specifically self organization - mind activity is always self organization. Consciousness is an evolving process of self organization. But the next question will be - what is self organization? This I don't know exactly, but it is the thing that causes the self assembly of everything in the universe. Ultimately this is what art is expressing.
T_Clark September 22, 2021 at 01:24 ¶ #598608
This is a very useful thread. It demonstrates how philosophers can take a relatively simple phenomenon and turn it into complete bullshit. The truly impressive part is that four or five people have accomplished this in completely different ways. I'm overwhelmed with admiration.

What the fuck? Self-organization! What does that even mean in this context.
frank September 22, 2021 at 01:28 ¶ #598609
Reply to T Clark Meanwhile you and praxis have become enraged over the problem. Really?
Constance September 22, 2021 at 01:29 ¶ #598611
Quoting frank
I think this point will make more sense to people who are into conceptual art. "Art" has different meanings depending on context of use, right?


I think art can be anything at all. Context of use would be the context of considering the object AS art. Other contexts, like taking the object as a weapon or as a door stop and so forth, are not contextualizing as art.
praxis September 22, 2021 at 01:33 ¶ #598612
Quoting Constance
This is nonsensical. You cannot have an out-of-context experience.
— praxis

No. The context is taking up a thing apart from others. Kant did this with reason. It is not that Kant thought reason could be conceived independently of context, but that putting selected contexts at bay in order to give analysis to one feature is what analysis is all about.


Analysis is about making sense, not nonsense.
praxis September 22, 2021 at 01:34 ¶ #598613
Quoting T Clark
take a relatively simple phenomenon and turn it into complete bullshit


Welcome to the art world. :lol:
Tom Storm September 22, 2021 at 01:46 ¶ #598615
Quoting Constance
But what is it you are fine with? I mean, what is it about art that makes it art such that a pile of bricks can be art?


This has been answered a few times both directly and indirectly. If it's on display as art it's art. You are being invited to consider something as an aesthetic experience. @Praxis put this well via @T Clark early in the thread. Whether that something is any good is a separate matter. It' s not my job to tell the world what can be considered art. But I know what I like (referencing earlier comment by O Welles).

Quoting T Clark
What the fuck? Self-organization! What does that even mean in this context.


Exactly.
frank September 22, 2021 at 01:52 ¶ #598617
Quoting Constance
Context of use would be the context of considering the object AS art.


I meant the context of the use of the word, "art".

For Nietzsche, we ourselves are the work of art, the challenge being to become conscious of this.

What was it for Heidegger? A fusion of purpose and matter?

I read once that philosophers usually write simplified synopses of their ideas when they talk about art. I wonder why?

RussellA September 22, 2021 at 10:52 ¶ #598734
Part of the problem when discussing "art" are problems with terminology. As I see it:

There are two meanings of aesthetics
Aesthetic as a verb means the study of beauty.
Aesthetic as a noun means a particular formal unity of parts within a complex and varied whole

There are two main definitions of art
Art as modernism, where aesthetic form and pictographic representative content have equal roles. An art going back the Lascaux cave paintings and beyond.
Art as postmodernism, where aesthetic form is deliberately excluded and the representation is symbolic. An art that originated in the 1960's.

Art as modernism can be further subdivided into Modernism, Expressionism, Baroque, etc.
Art as postmodernism can be further subdivided into Conceptual, Contemporary, Performance, etc.

There are two meanings of modernism
There is the modernism as an approach going back to the Lascaux cave paintings and beyond.
There is the Modernism of Monet and the Impressionists where the representation was of contemporary society rather than historical subject.

There are two meaning of contemporary
A contemporary artist can mean any artist currently living and who can be working in a variety of styles.
A Contemporary art is a subdivision of postmodernism, where artists from the 1960's onwards wanted to reconnect art with contemporary life.

There are two meanings of "an artwork has value"
It can mean that there is an object that can have aesthetic value independently of any observer.
It can mean that objects cannot have aesthetic value independently of any observer, but only in the mind of an observer.

The meaning of words can change with time
When today we use the word aesthetic, Kant in the 18th C would have used the term "free beauty"
When today we use the word beauty, Kant would have used the term "adherent beauty".

Things are complicated when contemporary commentators on Kant replace the term "free beauty" by "beauty"

The aesthetic and beauty have different meanings
The aesthetic form of an object is independent of the object's context, as an object's aesthetic is the formal arrangement of the parts within the object, not any external context.
The violence of a war can have an aesthetic and be ugly.
The serenity of a garden can have an aesthetic and be beautiful.

The "Artworld" is not "The Art World"
The "Artworld" has been hijacked by the postmodernists. This can be dated back to Arthur Danto's The Artworld, which gave the "institutional definition of art", defining art as whatever art schools, museums, wealthy collectors and the media say it is.
"The Art World" is the world of most everyday practising professional and non-professional artists, predominantly working in the modernist style .


IE, in discussions about art, as with philosophy in general, communication can break down when different contributors attach different meanings to the same words.
praxis September 22, 2021 at 13:44 ¶ #598814
Quoting RussellA
IE, in discussions about art, as with philosophy in general, communication can break down when different contributors attach different meanings to the same words.


Indeed, you seem to have made up your own meaning of aesthetic.

Quoting RussellA
The aesthetic form of an object is independent of the object's context, as an object's aesthetic is the formal arrangement of the parts within the object, not any external context.


I’ll wager that you can’t explain what this is supposed to mean.
Constance September 22, 2021 at 14:09 ¶ #598827
Quoting Pop
It is specifically self organization - mind activity is always self organization. Consciousness is an evolving process of self organization. But the next question will be - what is self organization? This I don't know exactly, but it is the thing that causes the self assembly of everything in the universe. Ultimately this is what art is expressing.


I have to disagree. The next question is not, what is self organization? It is, what is it IN self organization that makes art, art? It is not as if art AS cognition is art. Art as cognition is thought, concepts, propositions, meaning in connotation, denotation, (not to forget, deference and difference) and so on. I know my cat is on the sofa. I would claim this propositional knowing in the act of thinking it is inherently aesthetic, but AS cognition simpliciter, in the singular analysis of what a concept is, it is not aesthetic. This analytic treatment is abstract, of course, that is what analysis is: it abstracts from whole context to identify, explain, further analyze, a part.
Experience needs analysis to determine the existential foundation or art, a determination at the level of the most basic questions. I agree with Dewey in a qualified way: analyses like this look to experience as a whole. He thinks this is pragmatics, what you might call self processing information, and I don't disagree. But then he makes the critical move toward the aesthetic IN experience. You are not willing to this, it seems.
Constance September 22, 2021 at 14:11 ¶ #598829
Quoting praxis
Analysis is about making sense, not nonsense.


Vague reply. Don't be shy, tell me what you think in more detail.
praxis September 22, 2021 at 15:06 ¶ #598855
Reply to Constance

If you mean to try making sense out of nonsense, we'll need to go back to what you wrote earlier:

Phenomenologically: take the glee Hitler experienced as he gassed Jews. His glee is as a value experience is unassailable. It is simply a fact that he experienced this glee, say, and by itself, phenomenologically, that is, it is Good. What makes it bad is the context.


For starters, I don't think it's a good way to start an analysis by assuming something that is unverifiable. How could anyone really know how Hiter felt during the holocaust, much less 80 years after it occurred. You even go so far as to say that your claim about his feelings is indisputable.

You say that by itself his genocidal glee is good. This is your evaluation and can only mean that you think genocidal glee is good. You value genocide to a degree that it inspires delight in you.

You go on to say that genocidal glee is bad in context. This seems to mean that you value the feeling of delight that the idea of genocide inspires in you but in practice (any actual context) would be bad. This can only mean that you know that genocide is immoral and that it would be bad to practice because it's immoral or because society (other minds) consider it unacceptable and do not delight in the idea or practice of it.
Constance September 22, 2021 at 19:54 ¶ #598967
Quoting frank
I meant the context of the use of the word, "art".

For Nietzsche, we ourselves are the work of art, the challenge being to become conscious of this.

What was it for Heidegger? A fusion of purpose and matter?

I read once that philosophers usually write simplified synopses of their ideas when they talk about art. I wonder why?

Yes, he talk like that, I read. I have always thought N had to spend his life struggling, literally. Nothing but miserable health, and he had to overcome these to even write at all. Thus, we get overcoming as a principle theme. He had to "make" himself where others could relax.
Heidegger is too difficult to talk about causally. There is The Origin of the Work of Art and Question Concerning Technology that both come to mind. I'm reading Karsten Harries Art Matters that focuses on Heidegger's Origin. WIsh I could send it to you to talk about it. There is a strain of Hegel that runs through his thinking that says the art world has reached its end, and has divided: there is the disclosure of truth through art, then there is, well, Kitchy, ornamental, decorative aesthetic. Hegel though art had reached its end and can no longer contain spirit, having reached the length of its finitude. "Modern" art loses its spiritual dimension. Talking here about Renaissance art, genre painting and the absence of religious themes. Heidegger is not religious but does see modern art (here, early 20th century. Very erratic, scattered) as having lost something, just as he thinks WE, human dasein, gets lost in its own trivialities.
Purpose and matter? I's have to go back and read what he said about those Van Gogh shoes.
Constance September 22, 2021 at 20:15 ¶ #598975
Quoting praxis
For starters, I don't think it's a good way to start an analysis by assuming something that is unverifiable. How could anyone really know how Hiter felt during the holocaust, much less 80 years after it occurred. You even go so far as to say that your claim about his feelings is indisputable.

You say that by itself his genocidal glee is good. This is your evaluation and can only mean that you think genocidal glee is good. You value genocide to a degree that it inspires delight in you.

You go on to say that genocidal glee is bad in context. This seems to mean that you value the feeling of delight that the idea of genocide inspires in you but in practice (any actual context) would be bad. This can only mean that you know that genocide is immoral and that it would be bad to practice because it's immoral or because society (other minds) consider it unacceptable and do not delight in the idea or practice of it.


Not about Hitler. He was just there as an illustration. It could have been Genghis Khan or some schizophrenic. People do have, and have had, pleasurable feeling doing harm to others. That is it.

No, I am not saying his "genocidal" glee is good. Careful, lest you misconstruct the idea: Glee is a feeling that is what it is in all cases, hence the genereal concept. A child's glee, my glee when I see a friend, Hitler's glee when he eradicates those who he thinks interfere with his perfect world. Glee as such is just what it is, just as reason is what it is, not contingent on this or that problem solving. Modus ponens is the same essential logic whether Hitler uses it for more effective extermination techniques or Santa uses it to improve present delivery.

The unacceptableness remains the same. No one is arguing otherwise. But the question here is metaethical: what is the Good? and what is the Bad? in ethical matters. Moore thought the Good, qua phenomenon, to be a non natural quality: look at the pain and you can identify it as a fact and you can crowd the matter with explanatory context with talk about neuronal connectivity, C fibers firing, and so forth. But the pain as such, as it appears is irreducible. Here, we witness the Bad, the ethicall bad (not like a bad couch, e.g.).
This is how I am treating glee: Prior to entangled talk about the Third Reich, there is the more basic analysis of the phenomenon itself. Entanglements come after, and THEN we see the basis for condemnation. Oh! You mean glee that is about torture and murder!!!! That makes the case ethical.
frank September 22, 2021 at 21:11 ¶ #599019
Quoting Constance
Yes, he talk like that, I read. I have always thought N had to spend his life struggling, literally. Nothing but miserable health, and he had to overcome these to even write at all. Thus, we get overcoming as a principle theme. He had to "make" himself where others could relax.


He saw that in both Christianity and Schopenhauer, the Good is in the direction of the grave.

Consciousness requires the story arc which inevitably contains grief, rage, disappointment, etc. If the production and consumption of art is about experience, then it necessarily centers around evil.

Nietzsche didn't think we could overcome this. He thought we need to learn to embrace it, I think.

Quoting Constance
'm reading Karsten Harries Art Matters that focuses on Heidegger's Origin. WIsh I could send it to you to talk about it.


Me too.Quoting Constance
Modern" art loses its spiritual dimension. Talking here about Renaissance art, genre painting and the absence of religious themes. Heidegger is not religious but does see modern art (here, early 20th century. Very erratic, scattered) as having lost something, just as he thinks WE, human dasein, gets lost in its own trivialities.


But the whole time we were talking about how anything can be art, I was thinking of Andy Warhol, who became one of my favorites recently. The actual artifacts he left behind are a fairly small part of what his art is. It's all about the features of mundane experience.
praxis September 22, 2021 at 21:33 ¶ #599027
Reply to Constance

So you’re saying that there’s genocidal glee, just the concept of glee, and your mind can separate glee from any actual instance of glee, such as Hitler’s alleged genocidal glee.

If I’m following what you’ve said correctly, you’ve separated the concept of glee from what you’re now referring to as an illustrative example (glee in context) of glee in order to perform an analysis of some kind.

That’s about all the sense I can make out of what you’ve written. It not clear if this somehow relates to your claim that “the aesthetic is an integral part of experience itself.”

Perhaps your analysis has revealed that you have the capacity to consider the concept of aesthetic out of context, or that having this capacity, you can apply this concept any which way that your imagination can manage.
Pop September 22, 2021 at 22:21 ¶ #599043
Quoting Constance
He thinks this is pragmatics, what you might call self processing information, and I don't disagree. But then he makes the critical move toward the aesthetic IN experience. You are not willing to this, it seems.


Art is an expression of consciousness. At it's simplest, consciousness is mind activity. Although art is not exclusively an expression of mind activity, this is the singular thing we find in works of art - always. Every work of art ever made has to be an expression of mind activity, agreed?

Mind activity is experiential. Phenomenology elucidates mind activity very well. It elucidates how human consciousness self organizes. How cognition is a disturbance in a state, how an emotion is felt due to the implications of the disturbance, and how the state reintegrates. it outlines how a self realigns itself due to this process, and so is a product of this process, agreed?

So, art is an expression of mind activity, and mind activity is experiential, agreed?

The term consciousness already encompasses the experiential mind activity that composes it.

The experiential mind activity that creates consciousness is endlessly variable and open ended - we can see this in the art it creates - how it is always evolving- with no end in sight. Agreed? So it is not possible to define anything in terms of this, as it is endlessly variable, and open ended! And will continue to evolve into things we cannot possibly imagine.

So we are left with only mind activity to define art with. Agreed?

Hence art work is information about the artist's consciousness - This is all we can say that is. This information is present in every work of art. We cannot reduce this any further, and we can not add to it. Anything we add to this expression is not a constant of art. Only this expression is constant in art. So it is the only way to define art. Art can be defined to this extent and no further,.

Good Art - Bad Art

Consciousness is also about awareness. The difference between good art and bad art is the awareness of the artist. Great art displays an unusual - far from usual awareness of it's subject matter. Great art exceeds the normal expectation of art through the artists awareness of an extra dimension to the subject matter, that normal art does not see. This way great art can result in a shift in paradigm, about it's subject matter. We can not predict what the subject matter will be, but we can predict great art will have a mastery of it, and will provide avenues to go beyond the norm. So it is an expansion of consciousness about a subject matter. Human consciousness exists in a paradigm, and great art is enlightened compared to the norm, and can be a shift in paradigm. This is the story of art historically. This is how art progressed historically, and then post modernism put a spanner in the works :sad: but nevertheless art continues to progress in this way as it is a function of human consciousness, and this is what human consciousness does - it evolves and progresses. How can art not be information about this?
Tom Storm September 22, 2021 at 22:33 ¶ #599048
Quoting Pop
Consciousness is also about awareness. The difference between good art and bad art is the awareness of the artist. Great art displays an unusual - far from usual awareness of it's subject matter. Great art exceeds the normal expectation of art through the artists awareness of an extra dimension to the subject matter, that normal art does not see. This way great art can result in a shift in paradigm, about it's subject matter. We can not predict what the subject matter will be, but we can predict great art will have a mastery of it, and will provide avenues to go beyond it.


Goodness... Sorry but his sounds like vague and confused thinking. You still have unfinished work in explaining why consciousness and self-organization matters to this discussion since these two things could explain all human behavior. So what's specific about them in relation to art?

Now you talk about 'great art' in equally imprecise and empty terms.

Please provide an example of a work of great art and demonstrate how the below can be applied in our understanding of the work:

Quoting Pop
Great art displays an unusual - far from usual awareness of it's subject matter.



Santiago September 23, 2021 at 02:14 ¶ #599090
Reply to Pop It seems to me there are people actually defining art as: Everything, or anything.
Pop September 23, 2021 at 04:40 ¶ #599128
Quoting Santiago
It seems to me there are people actually defining art as: Everything, or anything


A definition requires a constant. Strictly speaking art can be anything deemed to be art, but to do this would be an expression of consciousness. Of course everything is an expression of consciousness, so it is also a constant in art - this allows a definition of art in terms of consciousness. When we examine what consciousness is, we find we are expressing self organization. Of course, what else could we possibly be expressing?

People can accept that everything can be art. And they can accept that everything is an expression of consciousness. But many cannot accept that therefore: art is an expression of consciousness.
Santiago September 23, 2021 at 05:12 ¶ #599131
Well, may not everybody is actually considering it an expression of conscience. I mean there are galerist that are interested in some kind of "medium" like doing the things by their own and the artist is just a hand. Of course those galerists are versed in abstract art. I mean I found my self as artist being suggested to act like this, so like don't thing or to take the led. Like demanding than a "real" artist is something like a "medium" that is guided by who knows who. If cours that is not ruling out your intention, or what it seems to me to be your intention. Than looks quite opposed to theirs. As far as I understand you are suggesting that art is something conscientiously done by an artist and is consequently linked to its conscience.
TheMadFool September 23, 2021 at 07:12 ¶ #599150
@Pop

The way it seems to me is philosophy of art is in the business of, ultimately, constraining art by defining it; a definition although good to have - we can know with 100% certainty what is and is not art, paving the way for deeper philosophical study of the subject - is, if one gives it some thought, a straitjacket - restricts/constrains/limits/ the artist by having to conform to the definition whatever that is.

Realize that the absence of a good definition of art is because artists have a finger in every pie - no domain of human experience remains untouched by artists. In other words, the so-called artistic license, a synonym for carte blanche, in English, do whatever the hell you want, results in a such diversity in the art world that philosophers of art can't, even if their life depended on it, pin down art, what it is.

Given all that, don't you think it's better not to define art? Why corral artists in the pen of a definition when you could let them roam wild, in complete freedom?
Pop September 23, 2021 at 07:40 ¶ #599166
Quoting TheMadFool
The way it seems to me is philosophy of art is in the business of, ultimately, constraining art by defining it; a definition although good to have - we can know with 100% certainty what is and is not art, paving the way for deeper philosophical study of the subject - is, if one gives it some thought, a straitjacket - restricts/constrains/limits/ the artist by having to conform to the definition whatever that is.


This definition doesn't restrict the artist in any way, other than in the understanding that art is not simply art about art - that it is always inherently meaningful. This has always been the case.

Without a definition anybody can just BS about art as they please. With a definition like this one, art becomes something substantial again.
TheMadFool September 23, 2021 at 07:43 ¶ #599169
Quoting Pop
Without a definition anybody can just BS about art as they please.


One man's poison is another man's food.
Banno September 23, 2021 at 07:46 ¶ #599170
Quoting Pop
This definition doesn't restrict the artist in any way, other than in the understanding that art is not simply art about art


User image

I haven't paid this thread much attention, because definitions are not all that helpful, but further, any definition of art will immediately encourage any sensible artist to produce something that does not meet that definition.

Ceci n'est pas un poste.
Pop September 23, 2021 at 07:52 ¶ #599174
Quoting Banno
I haven't paid this thread much attention, because definitions are not all that helpful, but further, any definition of art will immediately encourage any sensible artist to produce something that does not meet that definition.



:up: Yes they would if they could!!

This definition is itself an artwork - in the form of a scientific, irreducible, and falsifiable definition of art. :smile:
Banno September 23, 2021 at 07:59 ¶ #599177
Quoting Pop
:up: Yes they would if they could!!


Hence the image above. They apparently did.

Art about art.

The nemesis of your definition?

Ceci n'est pas un poste.
Pop September 23, 2021 at 08:05 ¶ #599180
Quoting Banno
Hence the image above. They apparently did.

Art about art.

The nemesis of your definition?


Nah, that is totally captured. It is not possible to make art without expressing your consciousness.
Something I keep repeating every few posts, but not many seem to get it. :sad:
Banno September 23, 2021 at 08:11 ¶ #599181
Reply to Pop So everything is art. Your definition is too surely too broad?

Ce n'est pas de l'art
Pop September 23, 2021 at 08:20 ¶ #599187
Quoting Banno
So everything is art.


This has been the understanding in art circles for the past 100 years or so, since Duchamp's urinal.

Quoting Banno
Ce n'est pas de l'ar


This is not art?
User image
Banno September 23, 2021 at 08:33 ¶ #599195
Quoting Pop
This has been the understanding in art circles for the past 100 years or so, since Duchamp's urinal.


What has?


Ce n'est pas une question.
Pop September 23, 2021 at 08:35 ¶ #599197
Quoting Banno
What has?


That anything deemed to be art, is art.
TheMadFool September 23, 2021 at 08:37 ¶ #599200
Quoting Pop
Without a definition anybody can just BS about art as they please.


This is exactly the attitude your definition attempts to address.
Banno September 23, 2021 at 08:37 ¶ #599201
Reply to Pop
Then the definition in your OP is wrong?

Ce n'est pas une définition?
Pop September 23, 2021 at 08:41 ¶ #599205
Quoting TheMadFool
This is exactly the attitude your definition attempts to address.


Yes by pointing out that even BS about art is an expression of consciousness.

Quoting Banno
Then the definition in your OP is wrong?


:roll: Ok, lets have it. What is your argument?
TheMadFool September 23, 2021 at 08:42 ¶ #599207
Quoting Pop
Yes by pointing out that even BS about art is an expression of consciousness.


There you go. Are you now going to desist from trying to define art?
Pop September 23, 2021 at 08:43 ¶ #599208
Quoting TheMadFool
There you go. Are you now going to desist from trying to define art?


Why would I do that?
Banno September 23, 2021 at 08:43 ¶ #599209
Quoting Pop
What is your argument?


In so far as I have one, that there's no point in attempting such a definition.

Ceci n'est pas une conclusion
TheMadFool September 23, 2021 at 08:44 ¶ #599210
Quoting Pop
Why would I do that?


Why restrict the artist or, more accurately, why would the artist give a damn about your definition?
Pop September 23, 2021 at 08:49 ¶ #599214
Quoting TheMadFool
Why restrict the artist or, more accurately, why would the artist give a damn about your definition?


It does not restrict anybody. There are no artist's lining up outside my door in order to give a damn about the definition. :lol: However, the definition IS scientific, irreducible, and falsifiable.
TheMadFool September 23, 2021 at 10:21 ¶ #599243
Quoting Pop
It does not restrict anybody. There are no artist's lining up outside my door in order to give a damn about the definition. :lol: However, the definition IS scientific, irreducible, and falsifiable.


My point is simple: Your definition is, all things considered, broad, very broad, an indication that art has a rich diversity, there's a lot to include in the definition; another way of saying that is there's no such thing as BS art and that, if you really think about it, means art can't be, and in my humble opinion shouldn't be, defined.
Hermeticus September 23, 2021 at 10:48 ¶ #599248
I quite like the Oxford definition of art.


The expression or application of human creative skill and imagination, typically in a visual form such as painting or sculpture, producing works to be appreciated primarily for their beauty or emotional power.


The "application of human creative skill and imagination" here is key imo. I understand it not just as the process of creating art but also as the process of perceiving art. Anything that creates a sensory stimulation could be deemed art but in order for it to be art, someone has to consider it as art.
Constance September 23, 2021 at 13:39 ¶ #599317
Quoting frank
Consciousness requires the story arc which inevitably contains grief, rage, disappointment, etc. If the production and consumption of art is about experience, then it necessarily centers around evil.

Nietzsche didn't think we could overcome this. He thought we need to learn to embrace it, I think.


Embrace it, or sublimate it, make it yield to our needs. I never found Nietzsche interesting enough to study. He is the post modern hero because he denies the primacy of "truth" and embraces the irrational features of our existence. His claim that human existence is a constructed enterprise is an existential defining notion (essence precedes existence, e.g.) but I find Kierkegaard more challenging. Hegel is much more interesting these days to me, since I realized Kierkegaard lifted his dialectics from him. Hegel is Derrida's key inspiration/progenitor.
Of course, there is in this religious metaphysics pounding away, but it's not stupid metaphysics. Just unfamiliar. There is such a thing as authentic metaphysics.
As to grief, rage, etc, there is something of this in Dewey given that a life empty of trouble never develops, and meaning never is produced, since meaning emerges out of problem solving and no trouble, no problems, then no meaning and no aesthetics.
But then, this takes a philosophical turn: Let's say you're right about evil narratives at the center of consciousness. I would prefer, simply, trouble, for "evil" is connotatively thick and I don't want to make matters unduly weird. At the most basic level, the trouble an inquiring mind faces is religio-philosophical. The final trouble, problem to solve. It needs to be looked at as a problem to solve, not as empty metaphysics.
frank September 23, 2021 at 14:41 ¶ #599360
Quoting Constance
Embrace it, or sublimate it, make it yield to our needs. I never found Nietzsche interesting enough to study. He is the post modern hero because he denies the primacy of "truth" and embraces the irrational features of our existence. His claim that human existence is a constructed enterprise is an existential defining notion (essence precedes existence, e.g.) but I find Kierkegaard more challenging


I think Nietzsche is like several truckloads of feces into which a few diamonds and sapphires have been scattered. My connection to Nietzsche deep, like in the direction of dreams. But weren't Nietzsche and K saying something similar? regarding accepting evil?

Quoting Constance
There is such a thing as authentic metaphysics.


Could you say more about that?

Quoting Constance
would prefer, simply, trouble, for "evil" is connotatively thick and I don't want to make matters unduly weird.


I get that. The evil here includes hunger, coldness, the struggle to put the idea in words. I just like the word evil. :nerd:

Quoting Constance
At the most basic level, the trouble an inquiring mind faces is religio-philosophical. The final trouble, problem to solve. It needs to be looked at as a problem to solve, not as empty metaphysics.


What's the final trouble?

praxis September 23, 2021 at 14:44 ¶ #599364
Quoting Pop
Without a definition anybody can just BS about art as they please.


You may have noticed that people can and often do BS as they please about all sorts of things, well defined or not. Art should probably be the least of our concerns when it comes to bullshitting. The only objective value in art is the skill in which it is executed, if the concern is with value. No one is fooled by an untrained violinist pretending to be a master, for instance.
Constance September 23, 2021 at 14:46 ¶ #599365
Quoting Pop
Art is an expression of consciousness. At it's simplest, consciousness is mind activity. Although art is not exclusively an expression of mind activity, this is the singular thing we find in works of art - always. Every work of art ever made has to be an expression of mind activity, agreed?


Okay.

Quoting Pop
Mind activity is experiential. Phenomenology elucidates mind activity very well. It elucidates how human consciousness self organizes. How cognition is a disturbance in a state, how an emotion is felt due to the implications of the disturbance, and how the state reintegrates. it outlines how a self realigns itself due to this process, and so is a product of this process, agreed?


AS stated, phenomenology can be consistent with this as long as you don't bring empirical sciences and their categories into it. These are to be suspended, and, by some post, post moderns like Michel Henry's thinking, this suspension can go all the way down to presence as such.
Quoting Pop
So, art is an expression of mind activity, and mind activity is experiential, agreed?


Okay.

Quoting Pop
The experiential mind activity that creates consciousness is endlessly variable and open ended - we can see this in the art it creates - how it is always evolving- with no end in sight. Agreed? So it is not possible to define anything in terms of this, as it is endlessly variable, and open ended! And will continue to evolve into things we cannot possibly imagine.


If you follow the arguments laid out by Hegel and later, art has a place, a limit, and art's true p0urpose is to represent/reflect spirit and profound metaphysical intimations. Art became secular and lost its course because it became, as you say, open ended. Medieval art art was deeply religious and authentic. Renaissance art turned toward culture and human affairs because art cannot pass beyond the symbolic limitations of representation. NOW it is free and open and looking for its own consummation, never to be found in culture.
I think this an interesting idea, really.
AS to evolving into things unimaginable, perhaps; I mean, art, as with all things, is driven by existing paradigms. Kuhn's Structures does not apply only to science. All things progress like this. Not sure what there is in art to evolve into, but likely it will be just an extension of what is known and worked out. High tech versions of what we already know, as with music: did Schoenberg and others REALLY change the face of music? No. We are rather stuck with the basics and their intuitive possibilities.

Quoting Pop
So we are left with only mind activity to define art with. Agreed?


With the one caveat that a term like "mind" we have in itself an open question. Heidegger used dasein, then there is the transcendental ego of Husserl, the generative source of the grounding of all things of Eugene Fink, the Citta of the Pali canon, and so on. It could be that the real unlimitedness is as Hegel said, without the rationalism: beyond art into foundation of experience itself. A move away from art. Art has the same destiny as all things: annihilation in the move toward finality and consummation in Being (aka, God).
Quoting Pop
Hence art work is information about the artist's consciousness - This is all we can say that is. This information is present in every work of art. We cannot reduce this any further, and we can not add to it. Anything we add to this expression is not a constant of art. Only this expression is constant in art. So it is the only way to define art. Art can be defined to this extent and no further,.


You mean, the artwork being external to the events within the artist or art observer, it can only indicate, be a signifier, for what is REAL, which can only be the experience itself. One should look at the artwork as the outward manifestation of an actual consciousness, and its value reducible to palpable consciousness.

SO. look at the Munch's Scream or listen to Ravel's Bolero, the actual painting or musical sounds/auditory vibrations, are NOT the actuality, just information about the reality, which is consciousness. And the aesthetic is just one feature of what art information can be about. The Scream's look of horror, the frustrated relationship of Bret and Jake in the Sun Also Rises and all the rest: these are information ABOUT internal affairs?

Is this what you are saying? If so, how do you separate the artwork (information) from consciousness? It would be like separating language from consciousness" Consciousness in the world (putting metaphysics aside) IS language, and language is not information about consciousness. Thus, The Scream certainly is an expression of mood, affect, but the painting is not reducible to this, for the painting is itself incorporated into the structure of consciousness.
If you are going to call something information, then it has to information ABOUT something. What is that? If it is consciousness, then you have to, in your descriptive account, explain where one ends and the other begins. Where is the to be drawn between information and what is real? Is it ALL information? Then nothing is information. Will you turn to hermeneutics?







frank September 23, 2021 at 14:55 ¶ #599371
Quoting praxis
No one is fooled by an untrained violinist pretending to be a master, for instance.


That's so true.

User image

Constance September 23, 2021 at 15:05 ¶ #599374
Quoting praxis
So you’re saying that there’s genocidal glee, just the concept of glee, and your mind can separate glee from any actual instance of glee, such as Hitler’s alleged genocidal glee.

If I’m following what you’ve said correctly, you’ve separated the concept of glee from what you’re now referring to as an illustrative example (glee in context) of glee in order to perform an analysis of some kind.

That’s about all the sense I can make out of what you’ve written. It not clear if this somehow relates to your claim that “the aesthetic is an integral part of experience itself.”

Perhaps your analysis has revealed that you have the capacity to consider the concept of aesthetic out of context, or that having this capacity, you can apply this concept any which way that your imagination can manage.


It is rather that there is one, final context, and that is at the basic level, and this is phenomenology. On ethics and aesthetics: take lighted match and apply it to your finger. Now, there is a lot one can say about this anatomically, motivationally, psychologically, and any other context you can imagine; but put those aside and consider only the pain itself, pain simpliciter, qualia-pain if you like, or, the phenomenon of pain eidetically free, or context free. Forget about whether you think this is possible (Dennett doesn't, but that is another argument) for it being there AT ALL is a context, you can, and many do, including myself, argue. But IN this most foundational context of observing the pain just as pain and not of or in this or that, the pain can be seen most vividly for what it is, and not for what something tells us it is.

This presence is, I argue, pure, or close to pure. Entangled, yes, but here in this "reduction" it stands before one as a pure presence, what it IS as presence prior, that is, logically prior, for you can't even think of Hitler's genocidal cruelty without know what pain is to begin with that makes the whole affair so horrible.
This is what I have in mind.
RussellA September 23, 2021 at 15:24 ¶ #599385
Quoting praxis
you seem to have made up your own meaning of aesthetic. I’ll wager that you can’t explain what this is supposed to mean.


Thinking about the meaning of aesthetics rather than the definition of aesthetics:

The belief that the aesthetic is Uniformity within Variety goes back to at least Aristotle

Aristotle's Poetics is the first surviving philosophical treatise about the theory of drama in literary works. He wrote "Tragedy is a representation of a serious, complete action which has magnitude, in embellished speech, with each of its elements [used] separately in the [various] parts [of the play] and [represented] by people acting and not by narration, accomplishing by means of pity and terror the catharsis of such emotions."

As regards Variety, complex plots have reversals and recognitions, threats are resolved, and many types of art are blended, including language and music.
As regards Uniformity, actions should follow logically from the situation created by what has happened before, poetic narratives are unified by a plot whose logic binds up the constituent elements by necessity and probability.

As Francis Hutcheson wrote in 1725: “What we call Beautiful in Objects, to speak in the Mathematical Style, seems to be in a compound Ratio of Uniformity and Variety; so that where the Uniformity of Bodys is equal, the Beauty is as the Variety; and where the Variety is equal, the Beauty is as the Uniformity”.

IE, The belief that the aesthetic is Uniformity within Variety goes back to at least Aristotle.

The aesthetic is in the observer's experience of the object's form, not in the object's form

There are certain objective facts that may be described regarding the meaning of aesthetic, but the subjective experience itself is beyond description as that needs direct acquaintance.

Subjective experiences can include the perceived sensation of the pain of a headache, the taste of wine, the redness of an evening sky, as well as aesthetic form. A subjective experience stands in contrast to a propositional attitude, a conscious visceral experience rather than an intellectual belief about the experience.

Starting with colour as an analogy, an observer observes a wavelength of 700nm. The observer can describe objective facts about the wavelength of 700nm, but cannot describe their subjective experience of the colour red. I can be described objective facts about a wavelength of 700nm, but I must have subjective acquaintance with the colour red.

Although the colour red is not in the object, the object is the cause of the subjective experience of the colour red, in that a change in the object may cause a cause in the subjective experience, ie, from red to blue. Although the object is the cause of the effect of subjective experience of red, the object does not determine that the subjective experience is red rather than blue say. The particular object is the cause of the subjective experience of red, which is external to the object, and not contained within the object.

Similarly, an observer observes a physical object, where the whole object is made up of parts, and the observer observes the parts and the relationships between the parts. The particular object is the cause of an aesthetic experience, which is external to the object, and not contained within the object. The particular form of the object is the cause of an aesthetic experience, and a subjective aesthetic experience is the effect. As effects are not contained in their causes, it is not the form of the object that is aesthetic but rather the observer's subjective experience of the form of the object.

IE, the aesthetic is in the observer's experience of the object's form, not in the object's form.

The aesthetic and Uniformity within Variety are both Kantian a priori knowledge

Kant in Critique of Reason wrote: i) "Space is a necessary a priori representation that underlies all other intuitions", ii) “any knowledge that is thus independent of experience and even of all impressions of the senses. Such knowledge is entitled a priori”, iii) “in whatever manner and by whatever means a mode of knowledge may relate to objects, intuition is that through which it is in immediate relation to them”, iv) "nothing in a priori knowledge can be ascribed to objects save what the thinking subject derives from itself".

Innate human a priori knowledge has been part of the evolution of sentient life since the Cambrian period 541 to 485 mya. Humans are born with significant innate a priori knowledge, such as the instinctive knowledge of the difference in touch between a hot and cold object, knowledge of spatial relationships in knowing whether object A is to the left or right of object B, knowledge of the difference between a red object and blue object, knowledge of the difference between horizontal and vertical lines as well as a rudimentary knowledge of the difference between good and bad, etc. If this were not the case then there would be classes in school teaching the subjective experience of hot and cold, red and blue, etc. However, whilst subjective experiences cannot be taught, the words describing these experience must be taught, whether hot and cold, chaud froid, caldo freddo, etc.

Included within such a priori knowledge is the aesthetic. 10 million people didn't visit the Louvre annually without a desire for an aesthetic experience, nor admire Derain's Collioure, never mind the classic lines of the Mercedes 560SL, the magnificence of the Empire States Building, the complex themes of Cervantes Don Quixote or the timelessness of Sade's Smooth Operator.

What these aesthetic experiences have in common is the observer's consciousness of an inexplicable, undeniable mysterious unity within what at first sight appears chaotic, unintelligible and complex. The conscious mind, in observing a world of seemingly chaotic complexity, is able to self-organise all this maelstrom of information using a priori knowledge of balance, colour, movement, scale, shape, good and bad and mixed with a fundamental morality into comprehensible and intelligible patterns of understanding - an aesthetic Uniformity within Variety.

IE, the aesthetic and Uniformity within Variety are both innate parts of the structure of the brain as Kantian a priori knowledge.

Summary

As the aesthetic as a formal arrangement of the parts within an object has been discussed since at least Aristotle, I would have thought the more difficult problem would be to give an example of an aesthetic that didn't depend on the formal arrangement of the parts within the object.
Constance September 23, 2021 at 16:09 ¶ #599411
Quoting frank
I think Nietzsche is like several truckloads of feces into which a few diamonds and sapphires have been scattered. My connection to Nietzsche deep, like in the direction of dreams. But weren't Nietzsche and K saying something similar? regarding accepting evil?


They are both appalled by philosophy's attempt to rationalize the world, leaving the true, well, power and the glory behind, civilized and contained and weak and objectified and reduced. K's issue ws with Christendom, Nietzsche the same, I guess; I mean, this emasculating metaphysics that takes great possibility and turns it monkish denies the greatness, the will to push through and create. K looked also to this authenticity that is oppressed or forgotten by the neutralizing effects of bad metaphysics and cultural distractions. There is something that has nothing whatever to do with reason that is always there: actuality. The actual is not rational, not part of God's rational self actualization (Zizek has a different take on Hegel in this. Available on youtube). But then K goes north and N goes south. Heaven and Earth. (Keep in mind N adored people like Emerson and his Transcendentalism-very religious and but very vivid and full of encounter and meaning. NOT the church's conventions and liturgies.)

Quoting frank
Could you say more about that?


Metaphysics can be absurd, but then, it can be just the stark admission that all constructions of what the world is both end in aporia, openness, indeterminacy, and are part and parcel of the perceptual acts that reveal the world at the perceptual level. This latter is what Buddhism is essentially about, for what is it to meditate like this? It is a very radical process that is not confined to any particular part of things, but is the whole of things. To meditate as the Buddha tells us is to annihilate the world, the stream of existence produced moment to moment that informs us, gives us the habits of familiarity we deploy in everyday living.
Get into this deeply, and metaphysics becomes a lived reality. This is a rather complex argument, and it takes more time and writing than is allowed here. But for now, Good metaphysics begins with the observation that finitude as an imposing totality on a world that defies all totalizing, and this is exactly what Nietzsche and Kierkegaard were about, I would argue, though it would take a thesis to do so.

Quoting frank
What's the final trouble?


why are born to suffer and die? What is the nature of value, or, metavalue? To borrow a term, we "totalize" the world with our systems of understanding. There remains below this, or above it, or amidst it, actuality, which defies this, cannot be reduced to ideas we have of this. To bring Levinas' thought in, in all our ideas, the ideatum exceeds what the idea is, the desideratum exceeds what it is we desire. This is a delicate juncture. We did not invent metaphysics at the basic level. We invented a lot of bad thinking, but this terminus we encounter when we raise our fist to the sky, say, is very real. It is real in thought and its concepts, and in the actuality they try to contain.
The ethical dimension to this is most disturbing, but this takes a phenomenological approach to see what it is we are fussing about so much when we talk about ethics and aesthetics: value. There you are, seat belted in your car, upside down, the gas slowing into the passenger compartment, then you detect the hint of smoke. The metaphysics of this situation is vry real, because once you exhaust all possible accountability, there is nothing else. The gravity of the condition exceeds the explanatory totality there is to account for it.
We are not, of course IN the situation above, but to conceive it honestly shows that ethical nihilism is foundational inadequate to "totalize" what it is all about.
The final trouble is metaethics.




T_Clark September 23, 2021 at 16:34 ¶ #599422
Quoting praxis
You may have noticed that people can and often do BS as they please about all sorts of things, well defined or not.


It's not bullshit. It's philosophy.
Khalif September 23, 2021 at 16:48 ¶ #599433
Quoting RussellA
Although the colour red is not in the object,


The color is not in the object but on the object.
T_Clark September 23, 2021 at 17:01 ¶ #599448
Quoting Pop
It is not possible to make art without expressing your consciousness.
Something I keep repeating every few posts, but not many seem to get it.


We get it, we just don't think it is a useful way of characterizing or defining art. People have been saying this to you ever since this thread started. People have explained their objections, but all you do is keep repeating yourself. There are three possibilities 1) You have not done a good enough job explaining yourself 2) You're wrong or 3) There's more than one reasonable and defensible way to define art.
frank September 23, 2021 at 19:25 ¶ #599500
Quoting Constance
We are not, of course IN the situation above, but to conceive it honestly shows that ethical nihilism is foundational inadequate to "totalize" what it is all about.
The final trouble is metaethics.


Morality is only half the concept, right? The other half is amorality.

You could say when we jump into the car, this is amoral Eros. There's no good nor evil yet because the story arc is at its beginning. There's no action to judge. Only once we're hanging upside down (which would be an odd place to end the story), do we lay out our condemnations. Morality is a post-event perspective. We weigh the actuality against the ideal.

Cognitive dissonance appears when we recognize that the very thing the artist needs: some sort of wreckage, is deadly to that innocent who climbed behind the wheel.

But then there's the world's pain. It's a burden for some. Nietzsche says that if you long to save the world, you're rejecting it at the same time. We can say yes to life. Accept the car wreck in all it's glory. Isn't that what the Knight of Faith does?

RussellA September 23, 2021 at 19:31 ¶ #599503
Quoting Khalif
The color is not in the object but on the object.


Supposing that humans didn't exist, would the colour red still be on the object ?
Pop September 23, 2021 at 21:04 ¶ #599523
Quoting RussellA
IE, in discussions about art, as with philosophy in general, communication can break down when different contributors attach different meanings to the same words.


:up: Thanks for the great post. With so many contrarians to attend to I forgot to comment on it. Yes, I also believe post modernism has made a mockery of art. I suspect neoliberalism and it's post modernist art, will be seen by future generations, in the midst of climate change and other environmental and social disasters, as similar stupidities.

The realization that information is fundamental, is growing , and so ultimately art also will have to be understood as being fundamentally information. And so then the question will be - art is information about what? And the answer to that is obvious.
Pop September 23, 2021 at 21:13 ¶ #599527
Quoting T Clark
We get it, we just don't think it is a useful way of characterizing or defining art


No you do not get it. It has nothing to do with your opinion, or whether you think something is useful or not. It is to do with whether the definition is valid - is this a scientific, irreducible, and falsifiable definition of art - this is the only issue that is relevant! All the rest is noise and opinion.

Can you invalidate the definition? If not, you have to concede it is a valid definition of art. End of story.
Pop September 23, 2021 at 21:16 ¶ #599529
Quoting TheMadFool
means art can't be


But I have defined it. You have to invalidate the definition, or otherwise accept it.
praxis September 23, 2021 at 21:18 ¶ #599530
Quoting RussellA
IE, the aesthetic and Uniformity within Variety are both innate parts of the structure of the brain as Kantian a priori knowledge.


We all know that people have the capacity for aesthetic experience. Was that ever in dispute?

Remarkably, in that long post you didn't use the word 'context' even once.
Pop September 23, 2021 at 21:21 ¶ #599532
Quoting praxis
No one is fooled by an untrained violinist pretending to be a master, for instance.


This is true regarding the violinist, but notions such as art about art are so dim witted! :grimace: Similar to philosophy saying - life is about life, no more needs to be said!
praxis September 23, 2021 at 21:22 ¶ #599533
Quoting RussellA
The color is not in the object but on the object.
— Khalif

Supposing that humans didn't exist, would the colour red still be on the object ?


Suppose that no human ever bothered to distinguish the color of red from other colors. They would need to learn the distinction as well as learn the word for red.
praxis September 23, 2021 at 21:31 ¶ #599535
Quoting Pop
This is true regarding the violinist, but notions such as art about art are so dim witted! :grimace: Similar to philosophy saying - life is about life, no more needs to be said!


We can make art about art and philosophize about philosophizing, or make art about philosophizing and philosophize about art. Use your imagination.
Pop September 23, 2021 at 21:40 ¶ #599545
Quoting Constance
With the one caveat that a term like "mind" we have in itself an open question


Yes, and this will remain an open question. This is what art is information about. Note how you have described how a changing social mind results in changing art. Mind or consciousness continues to evolve, and always will - and art will reflect this.

Quoting Constance
One should look at the artwork as the outward manifestation of an actual consciousness, and its value reducible to palpable consciousness.


Yes!! Now we are on the same page. That is all I am trying to say with the definition. Art is always some manifestation of this - an expression of human consciousness, for the consumption of another human consciousness. This is what it provides - constantly, and everything else is variable. This defines art.

Quoting Constance
If you are going to call something information, then it has to information ABOUT something.


Art is always information, and it is information about the artist's consciousness, and this information is entangled into the form of the art object, to be interpreted by another consciousness.
So, art is a process of communication, which depends on information, and the information, at all times, is about the artist's consciousness ( mind activity ) as it cannot be about anything else. This mind activity does not have any limits.
Pop September 23, 2021 at 21:41 ¶ #599548
Quoting praxis
We can make art about art and philosophize about philosophizing, or make art about philosophizing and philosophize about art. Use your imagination.


So if I was to say the comment you just made is words about words - you would be satisfied?

** I don't think you would.
praxis September 23, 2021 at 22:23 ¶ #599573
Quoting Constance
It is rather that there is one, final context, and that is at the basic level, and this is phenomenology. On ethics and aesthetics: take lighted match and apply it to your finger. Now, there is a lot one can say about this anatomically, motivationally, psychologically, and any other context you can imagine; but put those aside and consider only the pain itself, pain simpliciter, qualia-pain if you like, or, the phenomenon of pain eidetically free, or context free. Forget about whether you think this is possible (Dennett doesn't, but that is another argument) for it being there AT ALL is a context, you can, and many do, including myself, argue. But IN this most foundational context of observing the pain just as pain and not of or in this or that, the pain can be seen most vividly for what it is, and not for what something tells us it is.

This presence is, I argue, pure, or close to pure. Entangled, yes, but here in this "reduction" it stands before one as a pure presence, what it IS as presence prior, that is, logically prior, for you can't even think of Hitler's genocidal cruelty without know what pain is to begin with that makes the whole affair so horrible.
This is what I have in mind.


There's a couple of issues, I'm afraid, that prevent your 'reductionist' theory from rising above the level of nonsense. I already pointed out the first issue in my previous post. Using our imagination we can take a concept or general mental representation of something like aesthetic or pain and do whatever we want with it. We can associate pain with hot burning coals, for example, and that's relatively easy to do. It's a bit harder to associate pain with distant billowy clouds, but we can still do it. Anyway, jumping to the point, the point is that what we can imagine doesn't always correspond to reality. I suspect that you already know that, but in any case, a practical example may help to elucidate the point further.

Offhand, pain/panic is the most unaesthetic kind of experience that comes to mind. If I understand your reductionist theory rightly, we can 'reduce the context' of any situation where pain and panic are experienced and the experience will then be that of aesthetic experience. As I've pointed out, we can easily dismiss context with our imagination, but how do we do this in real life? How do we reduce or turn off context? For our purposes, it doesn't matter because reducing is changing, and we already know that changing a situation (context) can change our perception.

The second issue has to do with the basics of meaning. If everything is aesthetic then nothing is aesthetic and the concept loses all meaning.



praxis September 23, 2021 at 22:26 ¶ #599574
Quoting Pop
We can make art about art and philosophize about philosophizing, or make art about philosophizing and philosophize about art. Use your imagination.
— praxis

So if I was to say the comment you just made is words about words - you would be satisfied?


It wasn't about words, so no, I wouldn't be satisfied with that erroneous assessment. I could post something about words and then you could accurately say that I posted words about words.
Pop September 23, 2021 at 22:34 ¶ #599578
Quoting praxis
It wasn't about words, so no, I wouldn't be satisfied with that erroneous assessment. I could post something about words and then you could accurately say that I posted words about words.


The point I was trying to make is that you would not be satisfied with somebody calling your post arbitrary and indefinite - words about words. But some people are happy to leave art in a such a situation - as art about art.
praxis September 23, 2021 at 22:45 ¶ #599582
Reply to Pop

Your point is still far from clear. I've heard of 'art for art's sake', but I've never heard the expression 'art about art' and I don't know what it's supposed to mean beyond what it means at face value.
Pop September 23, 2021 at 22:50 ¶ #599587
Quoting praxis
and I don't know what it is supposed to mean


It means art for arts sake.
TheMadFool September 23, 2021 at 23:03 ¶ #599592
Quoting Pop
But I have defined it. You have to invalidate the definition, or otherwise accept it.


Indeed, you've defined it but my contention is that you had to make the definition so very broad, necessary since art is so variegated in nature, that you might as well not define it. Suppose you have a certain number of people in a room. You want to develop a criterion that includes everybody in the room but then you don't have to develop a criterion; you could simply say all people in the room.
praxis September 23, 2021 at 23:21 ¶ #599598
Quoting Pop
It means art for arts sake.


What's the problem with it? I basically interpret it to mean 'art for aesthetics' as opposed to art for profit, or art for deliberate messaging as in politizing, or art for any other utilitarian purpose. Of course, capitalist societies are loathe to the idea.
T_Clark September 23, 2021 at 23:22 ¶ #599599
Quoting Pop
All the rest is noise and opinion.


Of course it's opinion. Do you think your thoughts are somehow something somehow grander than your opinion? The definition you've provided is not a good one. People have been explaining why they think that since the thread started. You have not defended your position well. It doesn't work to just repeat yourself over and over.
Pop September 23, 2021 at 23:25 ¶ #599602
Quoting TheMadFool
You want to develop a criterion that includes everybody in the room but then you don't have to develop a criterion; you could simply say all people in the room.


I don't think this follows. Art was thought to be indefinite, but it is definite as per the definition, and then beyond this it is indefinite, for now at least. :smile:

You are not objecting to the definition, but to its utility. I have given my reasons, now several times, about how a definition is potentially useful.
Pop September 23, 2021 at 23:27 ¶ #599604
Quoting T Clark
Of course it's opinion. Do you think your thoughts are somehow something somehow grander than your opinion?


Mine is not opinion. Is 1+1 opinion? It is logical fact, as opposed to your opinion.
T_Clark September 23, 2021 at 23:29 ¶ #599606
Quoting Pop
Mine is not opinion. Is 1+1 opinion? It is logical fact, as opposed to your opinion.


Nuff said.
Pop September 23, 2021 at 23:31 ¶ #599607
Quoting praxis
What's the problem with it?


It trivializes art. Imagine philosophy for philosophy's sake.
Pop September 23, 2021 at 23:38 ¶ #599615
Quoting T Clark
Mine is not opinion. Is 1+1 opinion? It is logical fact, as opposed to your opinion.
— Pop

Nuff said.


What I meant is - the definition is not opinion.
T_Clark September 23, 2021 at 23:43 ¶ #599616
Quoting Pop
What I meant is - the definition is not opinion.


And what I meant is that we've taken this discussion as far as we can.
praxis September 24, 2021 at 00:07 ¶ #599625
Quoting Pop
What's the problem with it?
— praxis

It trivializes art. Imagine philosophy for philosophy's sake.


Most people think aesthetic experience is trivial, I believe, so you’re in [s]good company[/s] the majority.
Constance September 24, 2021 at 01:53 ¶ #599658
There's a couple of issues, I'm afraid, that prevent your 'reductionist' theory from rising above the level of nonsense. I already pointed out the first issue in my previous post. Using our imagination we can take a concept or general mental representation of something like aesthetic or pain and do whatever we want with it. We can associate pain with hot burning coals, for example, and that's relatively easy to do. It's a bit harder to associate pain with distant billowy clouds, but we can still do it. Anyway, jumping to the point, the point is that what we can imagine doesn't always correspond to reality. I suspect that you already know that, but in any case, a practical example may help to elucidate the point further.

Offhand, pain/panic is the most unaesthetic kind of experience that comes to mind. If I understand your reductionist theory rightly, we can 'reduce the context' of any situation where pain and panic are experienced and the experience will then be that of aesthetic experience. As I've pointed out, we can easily dismiss context with our imagination, but how do we do this in real life? How do we reduce or turn off context? For our purposes, it doesn't matter because reducing is changing, and we already know that changing a situation (context) can change our perception.

The second issue has to do with the basics of meaning. If everything is aesthetic then nothing is aesthetic and the concept loses all meaning.[/quote

Don't know why you want to talk about hot coals or billowy clouds. It isn't to the point. The reduction is the phenomenological reduction, which moves away from explanatory accounts that are merely factual, and this is important because facts are, as such, ethically arbitrary. In a typical ethical case, the facts are what they are, like you owning the gun I borrowed and wanting it back under, say, dangerous and suspicious circumstances. The gun ownership, the circumstances and so on, these are facts that have no ethical dimension to them as facts. As Wittgenstein put it in his Lecture on Ethics: in all facts of the world, were they laid out in a great book, there would not be a mention of value at all. The sun is further from earth that the moon: a fact, and as such, nothing ethical about it. Then what is it that makes the case ethical (or here, aesthetic; same applies here) at all? it is the value: the injury and pain that is at stake, also my breaking the implicit promise to return the gun that could undermine confidence that thereby undermines friendship and comfort, and so on.
So. you see the point being made here is to try to analyze an ethical case, any one at all, to find how its parts work, and what they are. This should be clear. Keep in mind that I am not the author of these ideas, but I do put them together as I see fit.
Not clear why you talk about panic. I don't want to muddle things with what is not at issue.


If all things are aesthetic, than nothing is aesthetic? If all things are in space, then nothing is in space? Are you kidding?
Constance September 24, 2021 at 01:55 ¶ #599661
Quoting praxis
There's a couple of issues, I'm afraid, that prevent your 'reductionist' theory from rising above the level of nonsense. I already pointed out the first issue in my previous post. Using our imagination we can take a concept or general mental representation of something like aesthetic or pain and do whatever we want with it. We can associate pain with hot burning coals, for example, and that's relatively easy to do. It's a bit harder to associate pain with distant billowy clouds, but we can still do it. Anyway, jumping to the point, the point is that what we can imagine doesn't always correspond to reality. I suspect that you already know that, but in any case, a practical example may help to elucidate the point further.

Offhand, pain/panic is the most unaesthetic kind of experience that comes to mind. If I understand your reductionist theory rightly, we can 'reduce the context' of any situation where pain and panic are experienced and the experience will then be that of aesthetic experience. As I've pointed out, we can easily dismiss context with our imagination, but how do we do this in real life? How do we reduce or turn off context? For our purposes, it doesn't matter because reducing is changing, and we already know that changing a situation (context) can change our perception.

The second issue has to do with the basics of meaning. If everything is aesthetic then nothing is aesthetic and the concept loses all meaning.


Again (technical issue screwed with the first)
Don't know why you want to talk about hot coals or billowy clouds. It isn't to the point. The reduction is the phenomenological reduction, which moves away from explanatory accounts that are merely factual, and this is important because facts are, as such, ethically arbitrary. In a typical ethical case, the facts are what they are, like you owning the gun I borrowed and wanting it back under, say, dangerous and suspicious circumstances. The gun ownership, the circumstances and so on, these are facts that have no ethical dimension to them as facts. As Wittgenstein put it in his Lecture on Ethics: in all facts of the world, were they laid out in a great book, there would not be a mention of value at all. The sun is further from earth that the moon: a fact, and as such, nothing ethical about it. Then what is it that makes the case ethical (or here, aesthetic; same applies here) at all? it is the value: the injury and pain that is at stake, also my breaking the implicit promise to return the gun that could undermine confidence that thereby undermines friendship and comfort, and so on.
So. you see the point being made here is to try to analyze an ethical case, any one at all, to find how its parts work, and what they are. This should be clear. Keep in mind that I am not the author of these ideas, but I do put them together as I see fit.
Not clear why you talk about panic. I don't want to muddle things with what is not at issue.


If all things are aesthetic, than nothing is aesthetic? If all things are in space, then nothing is in space? Are you kidding?
TheMadFool September 24, 2021 at 02:16 ¶ #599663
Quoting Pop
I don't think this follows. Art was thought to be indefinite, but it is definite as per the definition, and then beyond this it is indefinite, for now at least. :smile:

You are not objecting to the definition, but to its utility. I have given my reasons, now several times, about how a definition is potentially useful.


Your effort to define art is commendable of course for it's a holy grail of art philosophers but what I want to point out is that art has, in a sense, transcended philosophy if philosophy is about getting our hands on a crispy clear definition of art. Art has been allowed to explore the world on its own for too long - it's a wild animal now and taming it, which a definition is, is futile.
Pop September 24, 2021 at 02:27 ¶ #599665
Quoting TheMadFool
it's a wild animal now and taming it, which a definition is, is futile.


"Hard to see, the future is" - Yoda. :grin:
Constance September 24, 2021 at 02:29 ¶ #599666
Quoting frank
Morality is only half the concept, right? The other half is amorality.


I would deny that amorality is a fit description of the world at the basic level. Of course, I see as you do that the world does not give favor in its distribution of good and bad affairs, and in fact, on second thought, it likely favors the latter in terms of quantitative utility. But the argument I would defend would be grounded on qualitative distinctions.

Quoting frank
You could say when we jump into the car, this is amoral Eros. There's no good nor evil yet because the story arc is at its beginning. There's no action to judge. Only once we're hanging upside down (which would be an odd place to end the story), do we lay out our condemnations. Morality is a post-event perspective. We weigh the actuality against the ideal.


But the ontology of pain and bliss looks to neither the beginning nor the end. It simply takes what is there as it is, a phenomenon of certain properties. I am not concerned about how other matters work out, only one: I ask, what IS this pain. Does it have a nature that is clear and present, and that figures into our understanding of ethics and aesthetics? I am not judging actions, but trying to understand in any given action, what is it that makes it ethical? Call it a secret ingredient: value, the most mysterious thing in existence, by far.
Quoting frank
Cognitive dissonance appears when we recognize that the very thing the artist needs: some sort of wreckage, is deadly to that innocent who climbed behind the wheel.

But then there's the world's pain. It's a burden for some. Nietzsche says that if you long to save the world, you're rejecting it at the same time. We can say yes to life. Accept the car wreck in all it's glory. Isn't that what the Knight of Faith does?


You mean if the artist is a novelist. But for the painter, say, it is not a car wreck, but it is the struggle to produce affect (the aesthetic) in the medium. For the composer it is the same. For the player, it is mastery of the instrument and the "work" of the performance. And so on.
If the one bound to the car about to go up in flames grabs his pocket knife, struggles to cut free, then succeeds, then there is art in this, Dewey would say, and I would agree.
I am not interested in saving the world, but I do think if we are going to understand what it is that all the fuss is about, then we have to look at the aesthetic simplciter, as such? When I am in aesthetic rapture listening to whatever, what is this rapture? Asking what it is means to allow its presence to come forward and be acknowledged., apart from all the contextualizing.
The Knight of Faith is one who singularly lives in God's grace. See the first chapter of Fear and Trembling. S/he has posited spirit and unqualifiedly affirms God, the soul and their primacy over all things, securing eternal happiness. Abraham was this.
TheMadFool September 24, 2021 at 02:31 ¶ #599668
Quoting Pop
Hard to see, the future is" - Yoda. :grin:


Yep!
Constance September 24, 2021 at 02:54 ¶ #599679
Quoting Pop
Yes!! Now we are on the same page. That is all I am trying to say with the definition. Art is always some manifestation of this - an expression of human consciousness, for the consumption of another human consciousness. This is what it provides - constantly, and everything else is variable. This defines art.


Errr, no. Art still remains undefined, because the question is still there: what kind of meaning, aesthetic, value phenomenon is this that makes art, what it is?Is it emotional? Is it pragmatic? is it cognitive? Is it form? What is there is experience that is already there that is taken up in art? What is aesthetic rapture? Is beauty only art? Can art be ugly, and if so, what does this say about art as a general concept?

Or: you are saying artworks are essentially an index to states of mind, that they "carry" information about this inner experience, but: information as such is free of that which is carries, that is, information as information itself is not art, so calling art information certainly does not tell us anything about what art is; only that is can be represented in a medium and the medium is not the art--the interior experience is the locus of the REAL artwork.

What is "consumed" is not information.


Pop September 24, 2021 at 03:13 ¶ #599684
Quoting Constance
Or: you are saying artworks are essentially an index to states of mind, that they "carry" information about this inner experience,


Yes, that is a good way to put it.

Quoting Constance
the interior experience is the locus of the REAL artwork.


Art work is information about the artists consciousness.

Consciousness, or evolving process of self organization, is an umbrella term for the inner information that creates it, which you call - the interior experience or locus of the real artwork.

Consciousness, as an evolving process of self organization, encompasses all things mental and experiential.

Quoting Pop
According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us. Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning
praxis September 24, 2021 at 03:58 ¶ #599696
Quoting Constance
Again (technical issue screwed with the first)


Don’t ya hate that?! When all else fails click the edit button, which sits at the bottom of posts to the immediate right of the time stamp. You may need to tap on that spot in order to see the icon with three dots, and if you tap on that you’ll see the pencil icon. Tap on the pencil icon to edit posts.

Quoting Constance
Don't know why you want to talk about hot coals or billowy clouds. It isn't to the point.


How astute of you, indeed hot coals or billowy clouds are not the point, the point utilizing those examples was that what we can imagine doesn't always correspond to reality.

Quoting Constance
moves away from explanatory accounts that are merely factual


I’m not sure if it’s possible for you to move any further away from such a lowly place.

Quoting Constance
facts are, as such, ethically arbitrary


I suppose you’re right about that, the capricious little bastards.

Quoting Constance
you owning the gun I borrowed and wanting it back under, say, dangerous and suspicious circumstances.


Are you threatening me?

Quoting Constance
The gun ownership, the circumstances and so on, these are facts that have no ethical dimension to them as facts.


In my country there are laws about gun ownership which strongly suggests that there is in fact an ethical dimension to gun ownership.

Quoting Constance
As Wittgenstein put it in his Lecture on Ethics: in all facts of the world, were they laid out in a great book, there would not be a mention of value at all.


Not even the value of pie?!

Quoting Constance
Then what is it that makes the case ethical (or here, aesthetic; same applies here) at all? it is the value: the injury and pain that is at stake, also my breaking the implicit promise to return the gun that could undermine confidence that thereby undermines friendship and comfort, and so on.


No worries, keep the damn thing.

Quoting Constance
So. you see the point being made here is to try to analyze an ethical case, any one at all, to find how its parts work, and what they are. This should be clear.


Clear as mud at this point. :up:

Quoting Constance
Not clear why you talk about panic.


Because it’s the most unaesthetic kind of experience that readily came to mind. I explained that. Are you only skimming my posts? How dare you. :rage:

Quoting Constance
I don't want to muddle things with what is not at issue.


Good call.

Quoting Constance
If all things are in space, then nothing is in space? Are you kidding?


You said it, not me. If all things are in space, then all things are in space (as a matter of fact all things do appear to be in space). If all things are space, then all things are space, right? If all things are space then there’s nothing to compare space with, right? There is only space, so space has no meaning.
Merkwurdichliebe September 24, 2021 at 05:08 ¶ #599703
Quoting Pop
I'm trying to impress on you, but without much success, that consciousness is the root of creativity.
Consciousness unifies and integrates information.
Creativity unifies and integrates information
This bears thinking about.


I think I see what you are getting at. Let me see if I can clarify a bit. Phenomenalogically speaking, art is creation. Man creates himself and his world through art, and it is through the prism of art that man and the world appears as it does to man. Every category whereby man shares his knowledge is a form of art, it is a way in which mankind portrays, frames, interpret, imagines, communicates, &c. the world as it appears and seems.

I would go so far as to assert science to be the dominant artform of our time, having long ago replaced religion and myth (although not absolutely) as the way in which the world generally appears to man. The interesting thing is how religion/myth and science differ in essence. Science depends entirely on strict methodology and lacks a definitive ethical component, whereas religion/myth is exactly the opposite, a strict ethics and vague methodology. I could say more...

I believe there were some famous philosophers that implied or explicitly held aesthics to be a kind of a priori category, I would include Hegel, Nietzsche, Schopenhauer, and Kierkegaard amongst others.
Pop September 24, 2021 at 05:51 ¶ #599720
Quoting Merkwurdichliebe
I think I see what you are getting at. Let me see if I can clarify a bit. Phenomenalogically speaking, art is creation. Man creates himself and his world through art, and it is through the prism of art that man and the world appears as it does to man.


Yes basically. This definition of art is an artwork, in the form of a scientific, irreducible, and falsifiable definition of art, to the extent that art can be defined. Clearly art is information about human consciousness. I am amazed about the fuss.

It is often thought art is about aesthetics, but really it is about an artists interpretation of aesthetics. So it is aesthetics through their eyes, so their consciousness, entangled into the form of the art, to then be reinterpreted in terms of the consciousness of the viewer. So a consciousness to consciousness communication. Art needs to be in some form, so will have an aesthetic quality, but aesthetics need not be it's focus. It is unlimited in focus.
RussellA September 24, 2021 at 09:09 ¶ #599786
Quoting praxis
Remarkably, in that long post you didn't use the word 'context' even once.


In a previous post I wrote "The aesthetic form of an object is independent of the object's context, as an object's aesthetic is the formal arrangement of the parts within the object, not any external context. The violence of a war can have an aesthetic and be ugly. The serenity of a garden can have an aesthetic and be beautiful".

In this particular post I summarised with the phrase "aesthetic as a formal arrangement of the parts within an object". Although not specifically referring to the context of the object, the phrase infers that the object's context is not part of the object's aesthetic.
RussellA September 24, 2021 at 09:11 ¶ #599787
Quoting praxis
Suppose that no human ever bothered to distinguish the color of red from other colors.


When looking at the world, humans don't decide to distinguish between colours, but instinctively distinguish between colours, without thought or conscious effort.
RussellA September 24, 2021 at 09:12 ¶ #599788
Quoting Pop
post modernism has made a mockery of art


I agree - the postmodernist "Artworld" with its "institutional definition of art" is destroying any value in the definition of art by pushing the agenda that art is defined in whatever way they deem it to be defined.
Constance September 24, 2021 at 12:57 ¶ #599854
Quoting praxis
You said it, not me. If all things are in space, then all things are in space. If all things are space, then things are space, right? If all things are space then there’s nothing to compare space with, right? There is only space, so space has no meaning.


You're a good man...errrr...woman....errr person... you're a good agency of interlocution, Praxis, who can spin tedium into levity. The world needs more like you.
Constance September 24, 2021 at 13:49 ¶ #599869
Quoting Pop
Consciousness, as an evolving process of self organization, encompasses all things mental and experiential.

According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us. Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning


All I can say is, and I hope you give this more than a glancing thought, you're thesis is not about the definition of art. It is about the definition of the art object. You are saying, I am pretty clear by now, is that, that painting, novel, performance, and so on, are not where art is to be found. The true locus of art is experience, the perspective imposed on an object by the artist or observer, and here, of course, you have to distinguish yourself from others who argue like this.
I would otherwise be close to agreeing except for this big objection: the physical art work in its actual presence is also what is in my mind when I think of the artistic nature of the thing. In other words, one cannot call the one art and the other, the art object, information because when it comes to an analysis of the art itself and not the information, the object remains in place. In general information, too,one could make a similar claim: information as to how a computer mouse functions, say, is words on a page, or verbally produced; but the consciousness that receives it, understands it, does not stand apart from the words. It recalls the words, written or otherwise, IN the conscious event. So, the exteriority of the object is not detachable from the interior conscious event.
Not sure how you will handle this. Even in Dewey, the making of a chair and its physical engagement cannot beabout the making of a chair's interior value making events, for when this interior is conceived, the "object" dimension is necessarily there.
Constance September 24, 2021 at 13:57 ¶ #599870
Quoting RussellA
I agree - the postmodernist "Artworld" with its "institutional definition of art" is destroying any value in the definition of art by pushing the agenda that art is defined in whatever way they deem it to be defined.


An interesting statement, and I am inclined to agree, if it wasn't for impossibility of pinning art's definition elsewhere. How else can you account for art's infinite malleability? Where did art theory lose its way? When it abandoned beauty? Significant form? If you can't really say, then art remains an open concept, like ethics: we continually try to make sense out of it, but it seems it is the kind of thing lost in contingencies that cannot be settled.
And: in the end, all concepts are open. Art is just among the most intractable. The only way to pin it down is to move into metaphysics. This is not impossible, I claim.
TheMadFool September 24, 2021 at 15:19 ¶ #599879
Art began simple - as mere 2D shadows of the world around us depicting hunting scenes, herds of animals, etc. Artists then developed techniques to convey depth - they went to town with it. What followed was probably more because the novelty of 3D images wore off - artists took greater risks, they ventured into uncharted territories, and boldly presented never-before-seen works for consumption by connoiseurs and lay people alike. Artists, it seems, were under a great deal of pressure, or perhaps it was the strong creative impulse in them, that made them constantly reinvent themselves. By the time philosophers got involved, art was a literal smorgasbord of subjects and styles that it was quite impossible to find, paradoxically, a leitmotif for art, an activity that usually itself, as individual works, has one.
praxis September 24, 2021 at 15:46 ¶ #599886
Quoting RussellA
Suppose that no human ever bothered to distinguish the color of red from other colors.
— praxis

When looking at the world, humans don't decide to distinguish between colours, but instinctively distinguish between colours, without thought or conscious effort.


Unless you have perfect pitch you couldn’t hear a musical note and identify it. You could learn how to do this with practice however. Just because sense data is available doesn’t mean that we can naturally distinguish parts of it. We may be better at visual distinctions but we still need to learn how to make ever finer distinctions. A ‘colorist’ will be far better at distinguishing colors than the average.

In a study of ancient writing, it was discovered that black and white were the first colors mentioned, followed by red. Blue was the last, as I recall. Apparently some colors are more important than others, to humans, and the least important are distinguished last.
praxis September 24, 2021 at 16:00 ¶ #599887
Quoting RussellA
Remarkably, in that long post you didn't use the word 'context' even once.
— praxis

In a previous post I wrote "The aesthetic form of an object is independent of the object's context, as an object's aesthetic is the formal arrangement of the parts within the object, not any external context. The violence of a war can have an aesthetic and be ugly. The serenity of a garden can have an aesthetic and be beautiful".

In this particular post I summarised with the phrase "aesthetic as a formal arrangement of the parts within an object". Although not specifically referring to the context of the object, the phrase infers that the object's context is not part of the object's aesthetic.


As I repeatedly pointed out with Constance, we can easily dismiss context with our imagination, but in real life it may not be so easy. What does it even mean to say that an object can be removed from its external context? And are you saying that’s a requirement for aesthetic experience? If so, why would it be a requirement?
RussellA September 24, 2021 at 17:44 ¶ #599952
Quoting praxis
Unless you have perfect pitch you couldn’t hear a musical note and identify it. You could learn how to do this with practice however.
What does it even mean to say that an object can be removed from its external context?


If I see a letter box at the end of the street, I may have the subjective experience of the colour red.

I don't need to identify what shade of red it is in order to have the subjective experience of the colour red.

The aesthetic form of the object can be removed from its external context
My subjective experience of the colour red is independent of any function the letter box may have. Similarly, my subjective experience of the aesthetic form of the letter box is independent of any function that the letter box has.
praxis September 24, 2021 at 18:31 ¶ #599967
Quoting RussellA
The aesthetic form of the object can be removed from its external context
My subjective experience of the colour red is independent of any function the letter box may have. Similarly, my subjective experience of the aesthetic form of the letter box is independent of any function that the letter box has.


If you know what a letterbox is, and you know the color red, you'll experience a red letterbox. If you don't know what a letterbox is, you'll experience an unidentifiable red object. If you know what a letterbox is then you know what its function is. Do you know what the function is of something that you can't identify? No. Further, if you noticed a red letterbox out of context, that is, in a place where you don't normally see them, and a place where they can't function properly, such as standing in the middle of a lake, it would surprise you. Unless that was commonplace for some reason it would surprise you because according to your internal model of the world red letterboxes don't stand in the middle of lakes and your mind could not have predicted one being there. You could not help noticing and being surprised, whereas you may pass red letterboxes on the street all the time without noticing them.

Again, we can easily imagine a red letterbox out of context. In experience we cannot separate one from its context, though we can modify our model of the world to accommodate a new context.

frank September 24, 2021 at 18:33 ¶ #599968
Quoting Constance
I would deny that amorality is a fit description of the world at the basic level.


I would too. Amorality appears to you against a background of morality, and vice versa.

Quoting Constance
But the ontology of pain and bliss looks to neither the beginning nor the end. It simply takes what is there as it is, a phenomenon of certain properties. I am not concerned about how other matters work out, only one: I ask, what IS this pain.


Could be a result of hot sauce about to be drowned in some awesome beer as you celebrate with close friends. Could be the same pain in the back you've struggled to deal with for months and despair is setting in.

[I]What[/I] the pain is and how you deal with it is definitely a matter of how you cast it. Why would you analyze pain without a context? That doesn't happen very often.

Quoting Constance
The Knight of Faith is one who singularly lives in God's grace. See the first chapter of Fear and Trembling. S/he has posited spirit and unqualifiedly affirms God, the soul and their primacy over all things, securing eternal happiness. Abraham was this.


Particularly as he was about to kill his beloved son. What does that tell you?

Pop September 25, 2021 at 01:26 ¶ #600086
Quoting Constance
So, the exteriority of the object is not detachable from the interior conscious event.


Exactly - that is why the art work is information about what is occurring in the artist's mind, or in other words consciousness. Likewise this art object representing the artist's consciousness, then interacts with the consciousness of the viewer, to become something in their mind. So it is a communication of consciousness to consciousness and what is exchanged is information, but just like the information communicated in this forum, so little of it gels. :lol:
T_Clark September 25, 2021 at 02:15 ¶ #600096
Quoting Pop
So it is a communication of consciousness to consciousness and what is exchanged is information, but just like the information communicated in this forum, so little of it gels. :lol:


Alas, arrogance unmatched by intellectual content. Your ideas have been deservedly rejected by most members of the forum. Most people would take that as a sign to rethink their position. Anyone unwilling to face the fact that their positions might not be correct or not the only way of seeing things cannot truly considered a philosopher, or even an intelligent thinker.
Pop September 25, 2021 at 02:26 ¶ #600102
Quoting T Clark
Alas, arrogance unmatched by intellectual content. Your ideas have been deservedly rejected by most members of the forum. Most people would take that as a sign to rethink their position. Anyone unwilling to face the fact that their positions might not be correct or not the only way of seeing things cannot truly considered a philosopher, or even an intelligent thinker.


An opinion bereft of substance, in the face of a scientific, irreducible, and falsifiable definition of art.

Neither do you represent the opinion of the forum, nor have you provided an argument - opinionated noise, nothing more. :lol:
T_Clark September 25, 2021 at 02:38 ¶ #600104
Quoting Pop
So it is a communication of consciousness to consciousness and what is exchanged is information, but just like the information communicated in this forum, so little of it gels.


Quoting Pop
Neither do you represent the opinion of the forum, nor have you provided an argument


You gloat that people don't understand or agree with your ideas, then crow that the forum supports you.

Pop September 25, 2021 at 02:47 ¶ #600107
Quoting T Clark
You gloat that people don't understand or agree with your ideas


This is an imagination of your mind.

Quoting T Clark
then crow that the forum supports you.


Again you reveal your consciousness.



Still no argument. Still no substance. Just opinion philosophy. :lol:
T_Clark September 25, 2021 at 02:57 ¶ #600110
Quoting Pop
Still no argument. Still no substance.


I explained my ideas about art back in the beginning of the thread. I read your ideas but disagreed with them. I didn't respond because I thought others addressed your arguments effectively. When they did, all you did was repeat and repeat your litany - "a scientific, irreducible, and falsifiable definition of art."

My problem isn't with your ideas, although I disagree with them. It is the pompous, smug, condescending attitude with which you present and repeat, and repeat, and repeat them without addressing the arguments of those who disagree with you.
Pop September 25, 2021 at 03:10 ¶ #600114
Reply to T Clark Is this a forum about problems individuals have with other individuals?

If so, then my problem with you is that you seem to mistake your opinions for something of worth. Your opinions are just noise without substance, you provide no argument whatsoever.

Again more opinionated noise, in the face of a scientific, irreducible, and falsifiable definition of art.

What more needs to be said?
Constance September 25, 2021 at 03:17 ¶ #600116
Quoting frank
I would too. Amorality appears to you against a background of morality, and vice versa.


But then, what is morality, so that we can talk about amorality at all? This is, in keeping with the OP, an aesthetic question as well, by implication.

Quoting frank
Could be a result of hot sauce about to be drowned in some awesome beer as you celebrate with close friends. Could be the same pain in the back you've struggled to deal with for months and despair is setting in.

What the pain is and how you deal with it is definitely a matter of how you cast it. Why would you analyze pain without a context? That doesn't happen very often.


But how one casts it is incidental. We have the category of painful events. What is it that binds the particulars to the generality?

Quoting frank
Particularly as he was about to kill his beloved son. What does that tell you?


I take it as something other than what it seems. Putting aside the puzzle of Abraham, there is beneath ethics, and the principles we abide by, a vacuum. The real question is this: Is there a foundation for art and ethics that is absolute? This kind of thing is not presented to us in our principled thinking. It is as Hegel said, each affirmation made contains its own negation. K's point is that value has no grounding in ethics. The matter must go beyond ethics for its affirmation.
Constance September 25, 2021 at 03:26 ¶ #600121
Quoting Pop
Exactly - that is why the art work is information about what is occurring in the artist's mind, or in other words consciousness. Likewise this art object representing the artist's consciousness, then interacts with the consciousness of the viewer, to become something in their mind. So it is a communication of consciousness to consciousness and what is exchanged is information, but just like the information communicated in this forum, so little of it gels


But there was an objection in this! The term 'information' fouls up the works, for the painting, say, is not about a state of mind sans the painting. The painting itself cannot be reduced to information about something else, like ones and zeros of a program, because the consciousness that is the seat of art's meaning necessarily includes the painting itself. Take a Beethoven sonata. What is exterior is the vibrating piano strings, BUT, to say those vibrations are merely information about something else denies the obvious presence of those very sounds in the consciousness where the experience resides. That is, the art object is not some carrier of information; it is part and parcel of the art event within.
Address this??
praxis September 25, 2021 at 04:03 ¶ #600131
Quoting Pop
Again you reveal your consciousness.


You have to admit that this is an odd thing to say. Especially odd because in your very next post you say:

Your opinions are just noise without substance…


So is Clark revealing his consciousness or his opinions? He’s expressing his opinions, right? To actually reveal his consciousness we would somehow have to be able to be in Clarks mind and experience his consciousness. I can’t imagine how that’s possible, and neither can you, apparently.
frank September 25, 2021 at 04:29 ¶ #600138
Quoting Constance
The real question is this: Is there a foundation for art and ethics that is absolute?


If you mean a god you can pray to, no, there isn't. That's a fairy tale. If you mean some sort of Neoplatonic divinity, maybe.

T_Clark September 25, 2021 at 04:29 ¶ #600139
Quoting praxis
To actually reveal his consciousness we would somehow have to be able to be in Clarks mind and experience his consciousness.


Wait, that can't be right. If it were, that would mean my opinions are art, wouldn't it?
T_Clark September 25, 2021 at 04:31 ¶ #600140
Quoting Pop
If so, then my problem with you is that you seem to mistake your opinions for something of worth. Your opinions are just noise without substance, you provide no argument whatsoever.


As I pointed out, my problem isn't with your opinions, although they are clearly wrong. My problem is with the pompous, smug, condescending attitude with which you present and repeat, and repeat, and repeat them without addressing the arguments of those who disagree with you.
Merkwurdichliebe September 25, 2021 at 08:11 ¶ #600208
Quoting frank
Neoplatonic divinity, maybe.


At first, I read napoleanic divinity. Perhaps that could be an absolute foundation of art. Who knows?
frank September 25, 2021 at 09:59 ¶ #600226
Reply to Merkwurdichliebe
It would part chocolate, vanilla, and strawberry, so that would be omnibenevolent.
RussellA September 25, 2021 at 10:26 ¶ #600231
Quoting praxis
Again, we can easily imagine a red letterbox out of context. In experience we cannot separate one from its context,


I agree that I would have difficulty understanding what was going on if I saw an object such as a red letter box out of its normal context in the middle of lake

But I would have no trouble with my subjective experience of the colour red (or aesthetic form) regardless of the object's context - whether at the end of a street or the middle of a lake.
Constance September 25, 2021 at 13:35 ¶ #600271
Quoting frank
If you mean a god you can pray to, no, there isn't. That's a fairy tale. If you mean some sort of Neoplatonic divinity, maybe.


Both of these are beyond what the question asks. Is there a way to show that in ethics and aesthetics there is an absolute embedded in the essence of what they are? Give analysis to an instance of these and is their something that is "its own presupposition" that defies analysis? What ever this is, it is beyond contingency and would be ontologically just as grand or authoritative as any Biblical narrative or metaphysical construction. It would be part and parcel of the world, just as "factual" as any other fact, but then, ineffably unassailable.
frank September 25, 2021 at 14:24 ¶ #600283
Quoting Constance
Both of these are beyond what the question asks. Is there a way to show that in ethics and aesthetics there is an absolute embedded in the essence of what they are? Give analysis to an instance of these and is their something that is "its own presupposition" that defies analysis?


I think morality and amorality are aspects of one's perspective.

You can look at the Holocaust as a mountain of evil, or you can look at it the way a zoologist looks at the behavior of Asian hornets destroying bee hives.

You can flip back and forth between the two if you like. Where does an absolute show up in this situation?

Constance September 25, 2021 at 14:42 ¶ #600297
Quoting frank
I think morality and amorality are aspects of one's perspective.

You can look at the Holocaust as a mountain of evil, or you can look at it the way a zoologist looks at the behavior of Asian hornets destroying bee hives.

You can flip back and forth between the two if you like. Where does an absolute show up in this situation?


Ethics is analyzable at a level beneath perspective. Not that such perspectives don't exist, and that at a certain level of analysis, this "perspectivalism" doesn't work; it does. But here, one is asked to go deeper, e.g., it is not my perspective that makes medieval torture horrible.
praxis September 25, 2021 at 14:43 ¶ #600298
Quoting RussellA
But I would have no trouble with my subjective experience of the colour red (or aesthetic form) regardless of the object's context - whether at the end of a street or the middle of a lake.


Agree, and personally I find the idea of a mailbox standing in the middle of a lake rather aesthetically appealing.
Constance September 25, 2021 at 14:58 ¶ #600307
Quoting praxis
Agree, and personally I find the idea of a mailbox standing in the middle of a lake rather aesthetically appealing.


Then you think irony is art. But irony is cognitive. What can this be about?
RussellA September 25, 2021 at 15:10 ¶ #600310
Quoting praxis
I find the idea of a mailbox standing in the middle of a lake rather aesthetically appealing.


I can see your artwork Mailbox in Lake taking pride of place at the 2022 Venice Biennale. (y)
RussellA September 25, 2021 at 15:25 ¶ #600313
Quoting Constance
art theory



There are different approaches to a definition of art

1) Definitions as universal - @Pop wrote: "Art is an expression of human consciousness" - "consciousness unifies and integrates information, and I postulate - in a creative process. It seems consciousness is creativity" (y)

2) Definitions as abstract - @Constance wrote: "And: in the end, all concepts are open. Art is just among the most intractable. The only way to pin it down is to move into metaphysics. This is not impossible, I claim." (y)

3) Definitions as particular - @RussellA wrote: "the two main approaches to art are modernism and postmodernism. In modernism, the artwork is more important than the artist, the aesthetic is of equal importance to the representation and the representation is pictographic. In postmodernism the idea of the artwork is more important than the physical artwork, any aesthetic has been deliberately removed and any representation is symbolic rather than pictographic. (y)

4) Definitions as unhelpful - @Banno wrote: "definitions are not all that helpful, but further, any definition of art will immediately encourage any sensible artist to produce something that does not meet that definition" (n)

5) Definitions as futile - @TheMadFool wrote: "Art has been allowed to explore the world on its own for too long - it's a wild animal now and taming it, which a definition is, is futile." (n)

Definitions are important in understanding modernism

In postmodernism the meaning of art has become meaningless as anything can be art, such as Warhol's Brillo Boxes, so any attempt at an underlying definition becomes pointless.

However, in modernism, it is the case that some objects have artistic value, such as Matisse's Dance 1910, and some don't, such as Warhol's Brillo Boxes. If some objects within modernism have artistic value and some don't, there must be objective and subjective reasons. As modernist artworks have great social, cultural and intellectual value, intellectual curiosity requires an attempt to discover reasons why they hold such important meaning.

IE, definitions, as succinct summaries of complex ideas, are an important aspect in the understanding of modernism.

Definitions can communicate subjective experience

As with Mary in Mary's Room, Mary may know all the objective facts about the colour red, and yet never had the subjective experience of the colour red.

The value of a modernist artwork, its essence, is in its particular subjective experience. The idea that definitions are unhelpful in communicating the nature of art assumes that definitions can only describe objective facts and not subjective experiences. But definitions do more than this. Definitions communicate between people by describing the whole - "aesthetic form is unity of parts within a varied whole" - and naming the parts - "unity", etc. Linguistic communication depends on agreed public names having private subjective meanings.

IE, as definitions are able to communicate the subjective essence of an artwork by naming rather than describing, definitions are invaluable in any discussion about art.

Definitions are not futile

If definitions were futile, then we would be deep in a postmodernist Alice in Wonderland world where any word can mean whatever the speaker wants it to mean. This would result in the breakdown of communication, such that when I talk about my car I mean a small vessel for travelling over water, propelled by oars, sails, or an engine, and when I talk about my boat I mean a four-wheeled road vehicle that is powered by an engine

Definitions are not unhelpful
If definitions about art were unhelpful, the Tate would not write that "Performance Art is artworks that are created through actions performed by the artist or other participants, which may be live or recorded, spontaneous or scripted".

Or why the SEP have a 10,000 word long article on "The Definition of Art" - including Kant's definition as “a kind of representation that is purposive in itself and, though without an end, nevertheless promotes the cultivation of the mental powers for sociable communication”

Or the Minnesota State University's web site linking to Tolstoy's definition of art as "a means of union among men, joining them together in the same feelings, and indispensable for the life and progress toward well?being of individuals and of humanity."

IE, Even if there is no agreement as to a single definition of art, definitions are helpful in attempting to understand the meaning of art.

Summary

Any underlying definition of art is pointless in postmodernism, as anything can be art, but in modernism, definitions are an important aspect in understanding the great social, cultural and intellectual importance of modernist artworks.
Constance September 25, 2021 at 16:11 ¶ #600328
Quoting RussellA
Any underlying definition of art is pointless in postmodernism, as anything can be art, but in modernism, definitions are an important aspect in understanding the great social, cultural and intellectual importance of modernist artworks.


I don't buy any of this. The question of art lies with one question: is there anything that is both the essence of art, what makes art, art, and absolute? The reason art theory becomes so diffuse is because this question is considered a lost cause, and foundational talk "nonsense" (Wittgenstein encouraged the damage here).
But I claim art has this foundation: there is an intuitive absolute foundation to art, and that divergence in theory has entirely to do with the intellect's will to diversity. Hegel said that the object stands before the modern mind as an historical fixity with its own negation built into it, and this power of negation has no limit. In other words, anything and everything can be negated, thus, in the effort to affirm, there is instant denial. This, incidentally is also Derrida, or close. Putting aside the whole of Hegel's thought (pls!), he is right about this. Propositions are inherently defeatable. The only recourse in art (I say, though Hegel is over my shoulder) it to look for what is NOT propositional. Art has this, I say. It is called the aesthetic. And the historical movement away from this is simply word play. After all, words all carry their own begation.
Fascinating argument in this, but only if you're interested.
frank September 25, 2021 at 19:47 ¶ #600425
Quoting Constance
Ethics isanalyzable at a level beneath perspective. Not that such perspectives don't exist, and that at a certain level of analysis, this "perspectivalism" doesn't work; it does. But here, one is asked to go deeper, e.g., it is not my perspective that makes medieval torture horrible.


So when you say morality is beneath the level of perspective you mean you don't decide what's right and wrong. You want to identify the causal agent here, and its obviously beyond your whims?

I suppose a candidate would be Augustinean Christianity. "Love and do what you will". It's an amoral command, but it serves as a moral guide at the same time. And maybe love is unanalyzable. I'm not sure.

Anyway, you could think of it as where amorality meets it's opposite?

Pop September 25, 2021 at 22:33 ¶ #600483
Reply to Constance The Gel remark was not aimed at you or anybody specifically, it is just a fact of communication.

Quoting Constance
But there was an objection in this! The term 'information' fouls up the works, for the painting, say, is not about a state of mind sans the painting. The painting itself cannot be reduced to information about something else, like ones and zeros of a program, because the consciousness that is the seat of art's meaning necessarily includes the painting itself.


As per the definition, and the OP. Everything can be reduced to information, as otherwise how would you know about it? When you stand in front of a painting, it informs you - literally changes your neural state such that you become aware of it's presence.

Hopefully this establishes that art is information?

Now the question remains - Information about what? An artist is totally free to choose what their art will be. So, what they choose is a direct expression of their self - what they choose is congruous with how they understand themselves and the world that they live in. So it is information about them. It is not information about, say a flower, it is information about a flower as seen through the artist's eyes. This is always the case, in every detail, regardless of subject matter, that it is an interpretation by the artist. So it is an expression of their mind activity, or consciousness. It is always the case, and will necessarily always be the case, that the subject matter will reflect the consciousness of the artist - it does not appear in the artwork on it's own, but is caused to appear there by the artist, so is a reflection of the artist's thinking.

This is always the case, and it is most prominently exemplified in the work of artist's like Van Gogh, Munch, Bacon, Lucian freud, etc. There can be no doubt that it is their consciousness that is being expressed, as it is so different to the consciousness normally seen.

You do not enjoying the vibration of a piano string, you enjoy the arrangement of piano string vibrations, which is different for a Mozart, than it is for a Beethoven. You don't want to listen to some piano string vibrations, you want to listen to some Bach. No?

So, art work is information about the artist's consciousness.

Hopefully this answers your question - yes an art work is information, and it is information about the consciousness of the artist. It exists in some form, and this form by virtue of being something physical is aesthetic, so is always experiential. But there is nothing definite about the form, or any resultant aesthetic, or experience. We can not predict what the form of art will be in a hundred years, or the experience that will result from it, so can not define art in these terms. These terms are variable, they do not always exist in art, and it is unpredictable how they might exist in future. For a definition, we need to focus on the things that always exist in art, and the only thing that always exist in art is that art work is information about the artists consciousness - everything else is variable! That is why this is a definition - such as it is. :grin:

Pop September 25, 2021 at 22:53 ¶ #600489
Quoting praxis
So is Clark revealing his consciousness or his opinions? He’s expressing his opinions, right? To actually reveal his consciousness we would somehow have to be able to be in Clarks mind and experience his consciousness. I can’t imagine how that’s possible, and neither can you, apparently.


He reveals his consciousness through his vacant opinions, and troll like behavior.

It is not necessary to inhabit a persons consciousness to get a glimpse of it.

As we write these comments, to some extent, what we write is equal to our consciousness. Hence when we write, we express our consciousness. Much the same as with art, only the medium is different.
Pop September 25, 2021 at 23:00 ¶ #600494
Quoting T Clark
If so, then my problem with you is that you seem to mistake your opinions for something of worth. Your opinions are just noise without substance, you provide no argument whatsoever.
— Pop

As I pointed out, my problem isn't with your opinions, although they are clearly wrong. My problem is with the pompous, smug, condescending attitude with which you present and repeat, and repeat, and repeat them without addressing the arguments of those who disagree with you.



Pathetic, your argument has been so defeated, that now you misrepresent the situation and resort to name calling and an attack on character. It is a corruption of the process of debate, that is obvious to intelligence, but a small minded dim witted consciousness like your own would not be aware of that.
Given you understand so little else, perhaps you will understand this - put up, or shut up!

Quoting Pop
Mine is not opinion. Is 1+1 opinion? It is logical fact, as opposed to your opinion.


praxis September 25, 2021 at 23:40 ¶ #600508
Quoting RussellA
I can see your artwork Mailbox in Lake taking pride of place at the 2022 Venice Biennale. (y)


I doubt it would do well at even the neighborhood swap meet. More evidence that bad art can still be defined as art though. :razz:

User image

praxis September 25, 2021 at 23:59 ¶ #600515
Quoting Pop
So is Clark revealing his consciousness or his opinions? He’s expressing his opinions, right? To actually reveal his consciousness we would somehow have to be able to be in Clarks mind and experience his consciousness. I can’t imagine how that’s possible, and neither can you, apparently.
— praxis

He reveals his consciousness through his vacant opinions, and troll like behavior.

It is not necessary to inhabit a persons consciousness to get a glimpse of it.

As we write these comments, to some extent, what we write is equal to our consciousness. Hence when we write, we express our consciousness. Much the same as with art, only the medium is different.


Clark's artistic opinions are not his consciousness and it's a big stretch to say that they reflect his consciousness. He may, for some reason, express opinions that are not his own. He can communicate his own opinions with words. Can he communicate his consciousness with words? What does it even mean to communicate one's consciousness? Consciousness is a state of being awake and aware.
Pop September 26, 2021 at 00:15 ¶ #600523
Quoting praxis
Can he communicate his consciousness with words? What does it even mean to communicate one's consciousness? Consciousness is a state of being awake and aware.


We can not express anything other than our consciousness.

What is consciousness?

Quoting Pop
According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us. Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning

The singular thing that life is concerned with is to maintain and continue itself, and consciousness facilitates this. It is the one thing we are always expressing. We express it when making art, and it seems art's function is to express our consciousness when we personally cannot - to express it at its best, express it to many, and into the future.


Since this definition, and due to a wonder about what consciousness is, I came to define consciousness as an evolving process of self organization. But I don't know what the source of self organization is.

**In science, self organization caused life, In systems theory self organization caused order in the universe. That art also expresses consciousness / self organization is quite a big deal - I think anyway.
Constance September 26, 2021 at 00:57 ¶ #600533
Quoting frank
So when you say morality is beneath the level of perspective you mean you don't decide what's right and wrong. You want to identify the causal agent here, and its obviously beyond your whims?

I suppose a candidate would be Augustinean Christianity. "Love and do what you will". It's an amoral command, but it serves as a moral guide at the same time. And maybe love is unanalyzable. I'm not sure.

Anyway, you could think of it as where amorality meets it's opposite?


If we were talking in a scientific context, and I wanted to give analysis to, say, a rock formation or a symptom of something else, I would be looking causal accounts, yes. But this is more descriptive: I look at a rock formation and ask, what it is. This is classificatory, and in science, of course, it gets into taxonomic terms and features that these designate. In ethics and aesthetics, I observe what is there and ask the same question. Simple analysis: what is it that lies before me that everyone is calling art, that is, what is it that makes it art? The scientist's question is, what do I observe as identifiable features, and what are my classificatory options? The options are two: on the one hand, aesthetic, which have to do with value. This object (music, novel, poem, painting and so forth) is something "cared" for, the aesthetic being that which this caring is all about. On the other, there is cognition: talk about its features, predicative affairs like, the french horn's timbre contrasting against the sharp intrusion of the percussion, and so forth. The cognitive features of the judgment are always there, structuring the judgment, but as cognition, they are not what defines the art/music. The aesthetic does (which is why I like Dewey: the two are existentially one. Cognition is bound to the aesthetic, though, to know is not, as such, aesthetic.

To know about ethics or aesthetics, one has to first identify what it is be discussed. As with regular science, this begins with observation of unproblematic cases.

Again, art is entangled with all else, hence the confusion. Analysis abstracts from the whole to find the essential properties. like Kant did with reason. The assumption here is, cognition qua cognition is not wht art is about. I question, for example, that conceptual art is truly art. It is mostly a thesis.
praxis September 26, 2021 at 02:18 ¶ #600551
Quoting Pop
We can not express anything other than our consciousness.


Then how is it that I can’t even prove to you that I’m conscious? I could be a series of algorithms or an AI that lacks consciousness. There’s no way you could know and there’s no way that I can prove it to you. You can only know you’re conscious, or as I speculated earlier, somehow actually experience another’s consciousness.
T_Clark September 26, 2021 at 02:19 ¶ #600553
Quoting Pop
resort to name calling and an attack on character.


I did not call any names or comment on your character. I wrote about the "pompous, smug, condescending attitude with which you present and repeat, and repeat, and repeat them without addressing the arguments of those who disagree with you."

You, on the other hand, have talked about my "small minded dim witted consciousness."
RussellA September 26, 2021 at 07:51 ¶ #600609
Quoting praxis
art


If I could suggest a description for your next Venice Biennale exhibit : "Located somewhere between a fantastical reality and the political chaos of modern life, praxis' sculptures weave together multiple narrative threads. As a keen observer of complex social dynamics, he subverts conventional codes of representation through the language of narrative sculpture. Magnifying issues of inequality and political uncertainty, the picturesque beauty of his vivid landscape belies a sinister reality in which the collision of sumptuous detail and subtle colour provides an insight into the social mores and political ideologies of the working postman.

In my opinion, equal if not better than Teresa Margolles 2019 Venice Biennale exhibit.

User image
frank September 26, 2021 at 10:35 ¶ #600629
frank September 26, 2021 at 10:36 ¶ #600630
Quoting T Clark
You, on the other hand, have talked about my "small minded dim witted consciousness."


He's got a point though (just kidding).
Constance September 26, 2021 at 14:22 ¶ #600661


Quoting Pop
As per the definition, and the OP. Everything can be reduced to information, as otherwise how would you know about it? When you stand in front of a painting, it informs you - literally changes your neural state such that you become aware of it's presence.

Hopefully this establishes that art is information?


It is not that art is not information. It is about whether the art object is nothing but information, such that the thesis, "Art is information" holds up as a definition of art, as you say it does.

Everything is information, though I'm not sure you see it like this. You could say the tree standing before me is information: The observation itself is a thing of parts, the cognitive, the familiarity nd the recollection that makes it familiar, the implicit interest of looking at all. this latter is the aesthetic in everyday life. So put explicit information aside, like a newspaper: all I observe is like this; the world is information about myself (kind of what Kant was all about), the structure of thought exhibited in the form of judgment and perception (which leads to further dimensions in phenomenology). Further, the tree and everything about it, one could argue, is nothing BUT a reading of the productive source which is consciousness.
Such a surprisingly interesting issue. Here are a few thoughts, and I think, unless you can convince me otherwise, these have to be taken up to make your position tenable.

Look at what can be called an unproblematic case of information, say, stereo instructions or the daily news. These deliver information, and if there is an issue here, then the matter turns to the ambiguity of the term itself, that is, if the news isn't information, nothing is. Two things: First, it can be claimed that even when I read and am informed, the medium is not discarded as simply a vehicle for delivery. As I consider the "information" I am repeating the medium of delivery: words and their structure. But then, the point of information is to be about something else, the war overseas or the shortage in gasoline, and the words are not the news! I think this idea captures what information is. So when there is information, there is talk of something else entirely, and the medium is the vehicle for this something else.


I am convinced at this point that if something is to reduced to information, as you are doing, the information and its "aboutness" has to exhaust the analysis of the medium. But then the question arises: Is this possible? Can a medium of information be reduced exclusively to the terms of delivery? Words are not events in the news, but events in the news cannot be word-free affairs. Then again, two killed in a car accident is not the news about them being killed. It seems like it depends on what the information itself is. If I say what someone said earlier to inform you, then the saying the second time is the same or similar as the first, making the second information bearing utterance not merely information about the first, but essentially sharing in content. In this case, the utterance is not simply news about an event, but the event itself. And this is my current objection to your position: An art work, once exhaustively analysed as information about what is substantively an inner, consciousness affair, possesses something of that affair itself.

Respond? I mean, it's a genuinely interesting piece of philosophy you raised, but only as good as the such things as the above are given their due. (I'm not a fan of philosophy banter).

(In this is another issue: is conceptual art, really art?)

Second: What your definition lacks is an actual account of what the art IS, in the consciousness that receives it, creates it. I mean, if say X is the definition of art, and the true seat of art lies within and the object is simply that which carries it, deposits it, if you will, then a major part of your thinking should go to what it is that is there, in consciousness that the art work carries and delivers. This, I would think, is central to any definition of art.

My thinking has for while now been that to "discover" the essence of art, one has to do the phenomenological reduction of Husserl. See his Ideas I. An analysis at the level of basic questions, assumptions has to look at experience apophatically: not this, not that.
praxis September 26, 2021 at 15:24 ¶ #600675
Reply to RussellA

:lol: You got pro art-speak.
RussellA September 26, 2021 at 15:58 ¶ #600689
Quoting Constance
the essence of art


Language is not part of the essence of a modernist artwork.
I don't want to give the impression that I think that linguistic descriptions are part of the fundamental essence of a modernist artwork. Descriptions and definitions (succinct descriptions) may be helpful in the viewer's understand of the artwork but any such description is external to the artwork.

Though language is important in understanding the artwork
For example, when looking at a Classical Greek sculpture such as Laocoon and his Sons, admired by Hegel for its form and content, a deeper understanding of both the artwork and artist may be gained by knowing that for Hegel formal qualities meant "a unity and harmony of different elements in which these elements are not just arranged in a regular, symmetrical pattern but are unified organically" and content meant "an expression of freedom and richness of spirit".

Language is part of the essence of a postmodernist artwork
Language in postmodernism has a different function to that of language in modernism.
In postmodernism, there has been a blurring of the lines between art and language, where language itself has become a part of the artwork and where through the text the viewer is invited to directly engage with political and social issues within contemporary life. In postmodernism, the artwork is not an end in itself, but is an instrument by which the viewer is directed to political and social concerns held by the artist.

Modernism is more profound than postmodernism
Modernism (whose essence is aesthetic form of pictographic representation) enables a profundity not present in postmodernism because the viewer's interpretation is not restricted by having to comply with any language imposed on the artwork by the artist, as would be the case within a postmodernist artwork (where the aesthetic has been deliberately excluded and whose essence is symbolic representation).

IE, modernism is democratic in allowing the viewer a free interpretation, whereas postmodernism is authoritarian in directing the viewer's interpretation by means of the language imposed by the artist.
T_Clark September 26, 2021 at 17:21 ¶ #600720
Quoting frank
He's got a point though (just kidding).


I'll have you know that my dim witted consciousness is very large minded.
frank September 26, 2021 at 19:15 ¶ #600768
Quoting T Clark
ll have you know that my dim witted consciousness is very large minded.


I've always said you have a big head.
Pop September 26, 2021 at 20:47 ¶ #600796
Quoting praxis
Then how is it that I can’t even prove to you that I’m conscious? I could be a series of algorithms or an AI that lacks consciousness. There’s no way you could know and there’s no way that I can prove it to you. You can only know you’re conscious, or as I speculated earlier, somehow actually experience another’s consciousness.


You are arguing that you are AI, and thus unconscious? :chin:

Nah, an AI would recognize that my definition is logically watertight, so would accept and learn from it.
A human consciousness however, is bound by all sorts of complicated psychology, so will not easily accept the definition, rather it will express this psychology in it's attempt to negate the definition, despite lacking a logical basis.
Pop September 26, 2021 at 21:33 ¶ #600821
Quoting Constance
An art work, once exhaustively analysed as information about what is substantively an inner, consciousness affair, possesses something of that affair itself.


Yes, it possesses information about that affair, as you put it. It is entirely information about that affair.

Quoting Constance
Respond? I mean, it's a genuinely interesting piece of philosophy you raised, but only as good as the such things as the above are given their due. (I'm not a fan of philosophy banter).



You have answered your own question, but don't seem to realize it. I have answered you repeatedly and exhaustively.

Quoting Constance
(In this is another issue: is conceptual art, really art?)


Anything deemed to be art is art, end of enquiry. This is because we have a long history of this being the case, and the fact that art was thought to be indefinite.

Quoting Constance
Second: What your definition lacks is an actual account of what the art IS, in the consciousness that receives it, creates it. I mean, if say X is the definition of art, and the true seat of art lies within and the object is simply that which carries it, deposits it, if you will, then a major part of your thinking should go to what it is that is there, in consciousness that the art work carries and delivers. This, I would think, is central to any definition of art.


As I have explained a number of times now - we cannot predict what art will be in its form, or what the experiential reaction to this form will be. These things are endlessly variable and open ended, so can not form part of any definition of art.

Quoting Pop
Hopefully this answers your question - yes an art work is information, and it is information about the consciousness of the artist. It exists in some form, and this form by virtue of being something physical is aesthetic, so is always experiential. But there is nothing definite about the form, or any resultant aesthetic, or experience. We can not predict what the form of art will be in a hundred years, or the experience that will result from it, so can not define art in these terms. These terms are variable, they do not always exist in art, and it is unpredictable how they might exist in future. For a definition, we need to focus on the things that always exist in art, and the only thing that always exist in art is that art work is information about the artists consciousness - everything else is variable! That is why this is a definition - such as it is. :grin:


There is a limit to art however, and that limit is the artists thinking - an artist cannot make art about something that they cannot think about. So art is an expression of consciousness, and no more. It is not an expression of something beyond the consciousness of the artist - cannot possibly be. So is information about the consciousness of the artist, including the subconscious.


Quoting Pop
Exactly - that is why the art work is information about what is occurring in the artist's mind, or in other words consciousness. Likewise this art object representing the artist's consciousness, then interacts with the consciousness of the viewer, to become something in their mind. So it is a communication of consciousness to consciousness and what is exchanged is information.


** Art can be many wonderful things, and it constantly evolves into new things. This emergent process can not be predicted, any more than the future can be predicted, so can not be defined. Art can only be defined by the process that gives rise to it. Hence art is an expression of human consciousness, art work is information about the artist's consciousness, but human consciousness grows and grows - art reflects this. It reflects this historically and will reflect this into the future.
praxis September 26, 2021 at 23:13 ¶ #600856
Quoting Pop
Then how is it that I can’t even prove to you that I’m conscious? I could be a series of algorithms or an AI that lacks consciousness. There’s no way you could know and there’s no way that I can prove it to you. You can only know you’re conscious, or as I speculated earlier, somehow actually experience another’s consciousness.
— praxis

You are arguing that you are AI, and thus unconscious? :chin:


No argument is required. I'm merely pointing out that you can only assume that I'm conscious, you can't know that I'm conscious, so I could not be expressing something that you cannot know even exists. The words and ideas that I express, on the other hand, are evident.
frank September 26, 2021 at 23:39 ¶ #600865
Reply to praxis
Is that your argument for why Pop is wrong? That he can't know you're conscious? Just curious.
praxis September 26, 2021 at 23:55 ¶ #600875
Reply to frank

I would rephrase that to say that Pop can know my opinions and such, but Pop can never know my consciousness because to know it Pop would have to experience it somehow. Pop would have to know what it feels like for me to be conscious. Maybe it's not so different than Pop consciousness, or Frank consciousness. Maybe it's very different. Does anyone really know?
frank September 27, 2021 at 00:14 ¶ #600880
Quoting praxis
Maybe it's not so different than Pop consciousness, or Frank consciousness. Maybe it's very different. Does anyone really know?


One possible response to that would be that the same is true of your aquaintance with the world in general. Is it what you think it is? Couldn't it be very different? And of course it could be.

But in spite if this, you appear to place a great deal of confidence in your communication with the world through sense and reason. So for all practical purposes you're a realist.

Pop is a consciousness realist in much the same way. The reason we might readily accept realism wrt the world, but be shy about accepting consciousness on the same basis is related to the intellectual fashion of our time, but just in terms of logic, Pop's ideas are about as well founded as any other kind of realism.

Pop September 27, 2021 at 00:15 ¶ #600882
Quoting praxis
No argument is required. I'm merely pointing out that you can only assume that I'm conscious, you can't know that I'm conscious, so I could not be expressing something that you cannot know even exists.The words and ideas that I express, on the other hand, are evident.


Even if you were an Ai, you would still be expressing a consciousness, but this time the consciousness of your programmer, until such a time as AI becomes conscious itself.

In panpsychism, consciousness is fundamental, and is the only thing anything ever expresses through it's form. Long story. So I know that if anything should ever be expressed, that it will be consciousness.

There is a theoretical basis for my assertions, so if you were not conscious panpsychism would fall down - so you had better be conscious. :lol:

I can only know my own consciousness, and I know that I can only express my consciousness - there is nothing I can do other than express my own consciousness. So I can know this is also the case for you, although I can not know your consciousness - other then through its expression. It is not necessary for me to know your consciousness in it's entirety, since through expression you provide me with glimpses of it.

If you are arguing epistemic solipsism, then I would disagree. My understanding is founded in systems theory, and solipsism is BS from this perspective.
praxis September 27, 2021 at 04:28 ¶ #600983
Quoting frank
… you appear to place a great deal of confidence in your communication with the world through sense and reason. So for all practical purposes you're a realist.


In case you haven’t noticed, mailboxes don’t usually stand in the middle of lakes, and yet you attempt to categorize me as a realist. :brow:

Quoting Pop
Even if you were an Ai, you would still be expressing a consciousness, but this time the consciousness of your programmer


Perhaps the programmer also lacks consciousness.

Quoting Pop
In panpsychism, consciousness is fundamental, and is the only thing anything ever expresses through it's form. Long story. So I know that if anything should ever be expressed, that it will be consciousness.


This is entirely meaningless as it stands. If you have to tell a long tale for it to convey anything meaningful then tell your long tale.

:snicker: But we both know that you have no story to offer.

Quoting Pop
There is a theoretical basis for my assertions


We’re on page 14, if there were a theoretical basis for you assertions I suspect that we would have heard a peep of it by now.

Quoting Pop
I can only express my consciousness - there is nothing I can do other than express my own consciousness.


Nonsense, although you are definitely having trouble expressing this alleged theory you mention.

Quoting Pop
It is not necessary for me to know your consciousness in it's entirety, since through expression you provide me with glimpses of it.


You said yourself that “I can not know your consciousness.

If it turned out that I am an AI without consciousness, which is certainly a possibility, according to your beliefs it wouldn’t matter because ‘anything expressed is consciousness’. A plant bending towards the sun is expressing its consciousness, right? But no, you agree that an AI can lack consciousness.

I don’t provide you with glimpses of consciousness. I show signs of consciousness and if you want to call that expressing consciousness it is only expressing indications that I may be conscious. I express thoughts, beliefs, feelings, opinions, etc.
Constance September 27, 2021 at 13:55 ¶ #601138
Quoting RussellA
Language is not part of the essence of a modernist artwork.
I don't want to give the impression that I think that linguistic descriptions are part of the fundamental essence of a modernist artwork. Descriptions and definitions (succinct descriptions) may be helpful in the viewer's understand of the artwork but any such description is external to the artwork.

Though language is important in understanding the artwork
For example, when looking at a Classical Greek sculpture such as Laocoon and his Sons, admired by Hegel for its form and content, a deeper understanding of both the artwork and artist may be gained by knowing that for Hegel formal qualities meant "a unity and harmony of different elements in which these elements are not just arranged in a regular, symmetrical pattern but are unified organically" and content meant "an expression of freedom and richness of spirit".

Language is part of the essence of a postmodernist artwork
Language in postmodernism has a different function to that of language in modernism.
In postmodernism, there has been a blurring of the lines between art and language, where language itself has become a part of the artwork and where through the text the viewer is invited to directly engage with political and social issues within contemporary life. In postmodernism, the artwork is not an end in itself, but is an instrument by which the viewer is directed to political and social concerns held by the artist.

Modernism is more profound than postmodernism
Modernism (whose essence is aesthetic form of pictographic representation) enables a profundity not present in postmodernism because the viewer's interpretation is not restricted by having to comply with any language imposed on the artwork by the artist, as would be the case within a postmodernist artwork (where the aesthetic has been deliberately excluded and whose essence is symbolic representation).

IE, modernism is democratic in allowing the viewer a free interpretation, whereas postmodernism is authoritarian in directing the viewer's interpretation by means of the language imposed by the artist.


I don't buy any of this. The question of art lies with one question: is there anything that is both the essence of art, what makes art, art, and absolute? The reason art theory becomes so diffuse is because this question is considered a lost cause, and foundational talk "nonsense" (Wittgenstein encouraged the damage here).
But I claim art has this foundation: there is an intuitive absolute foundation to art, and that divergence in theory has entirely to do with the intellect's will to diversity. Hegel said that the object stands before the modern mind as an historical fixity with its own negation built into it, and this power of negation has no limit. In other words, anything and everything can be negated, thus, in the effort to affirm, there is instant denial. This, incidentally is also Derrida, or close. Putting aside the whole of Hegel's thought (pls!), he is right about this. Propositions are inherently defeatable. The only recourse in art (I say, though Hegel is over my shoulder) it to look for what is NOT propositional. Art has this, I say. It is called the aesthetic. And the historical movement away from this is simply word play. After all, words all carry their own begation.
Fascinating argument in this, but only if you're interested.
frank September 27, 2021 at 14:24 ¶ #601148
Quoting praxis
In case you haven’t noticed, mailboxes don’t usually stand in the middle of lakes, and yet you attempt to categorize me as a realist.


It reminded me of the Rocky Mountains, which I associate with wildness like in The Revenant.

The mailbox is a resident of quiet neighborhoods. My neighbor's son ran over my mailbox. None of them ever told me, but I noticed the son's car parked down the street with a dent that fit my mailbox.

This was last year when we got so much rain my front yard was completely mud. So I just pushed the mailbox back upright and now the clay earth has hardened around it and it's ready to destroy somebody else's car.

Mailbox upright in a lake.
praxis September 27, 2021 at 14:50 ¶ #601155
Reply to frank

The heroic images of you struggling to push up your rundown letterbox in the mud and rain is mildly amusing, so thanks for that. It is also strangely symbolic, but symbolic of what I cannot say. :chin:
RussellA September 27, 2021 at 14:55 ¶ #601158
Quoting Constance
is there anything that is both the essence of art, what makes art, art, and absolute?......But I claim art has this foundation......Art has this, I say. It is called the aesthetic......Propositions are inherently defeatable........ words all carry their own begation...


The problem is, how can the idea that "the essence of art is as an aesthetic" be expressed but not in propositional form, if as you say that "propositions are inherently defeatable" and "words all carry their own negation" ?
frank September 27, 2021 at 15:00 ¶ #601159
Quoting praxis
is also strangely symbolic, but symbolic of what I cannot say. :chin:


You probably just need to get more sleep. Or get laid. Both contribute to well-being.
praxis September 27, 2021 at 15:33 ¶ #601166
Reply to frank

Interesting, perhaps your mentioning sex is your subconsciousness trying to express the meaning of the symbolism. You did say that the earth is “hardening” and your erect mailbox is ready to destroy somebody else’s “car” in the neighborhood. It sounds an awful lot like you’re the one in desperate need of a leg over, or at least that’s what your subconsciousness is expressing.
frank September 27, 2021 at 15:45 ¶ #601170
Quoting praxis
your erect mailbox is ready to destroy somebody else’s “car” in the neighborhood.


Freud would advise that you see some relationship between sex and destruction, or death. That's why you haven't pursued this zesty enterprise as you could have: you see sex as the death of your creative potential which you want to preserve for your artistic shenanigans.
Deleted User September 27, 2021 at 16:02 ¶ #601175
This user has been deleted and all their posts removed.
praxis September 27, 2021 at 16:31 ¶ #601177
Reply to frank

To paraphrase the immutable words of Sigmund Freud, sometimes a letterbox is just a letterbox.

And holding the note…

Quoting tim wood
The TPF education-in-a-paragraph.


We can’t think for ourselves?
RussellA September 27, 2021 at 16:50 ¶ #601184
Quoting Pop
When art is undefined it fragments


An object can only have value if first defined. An object defined as a ship that sinks on first entering the water can rightly be said to be no good as a ship. The same object defined as a submarine that sinks on first entering the water may rightly be said to be good as a submarine.

With postmodernism, where anything can be art, then there cannot be good art or bad art. Then the well-known artwork A mail box in a lake is equal to the most prominent postmodernist works in the San Francisco Museum of Modern Art (badly named, however)

But in modernism, where art has been defined (albeit in more than one way), there can be good and bad art. Then a child's crayon sketch of a dog can never be the equal of a Rembrandt or Matisse.
Deleted User September 27, 2021 at 17:12 ¶ #601190
This user has been deleted and all their posts removed.
praxis September 27, 2021 at 17:36 ¶ #601199
Reply to tim wood

I couldn't care less about what the powerful or the knowledgeable consider good art because I can think for myself and I'm not a mindless herd animal.
Constance September 27, 2021 at 17:37 ¶ #601200
Quoting RussellA
The problem is, how can the idea that "the essence of art is as an aesthetic" be expressed but not in propositional form, if as you say that "propositions are inherently defeatable" and "words all carry their own negation" ?


Why, RussellA, you surprise me. That IS the question. It is the issue of "presence" or the metaphysics of presence, which issues from the assumption that any given moment of experience can never be this immediate apprehension: affirmations of the world are inherently expressions of underlying complexity, "adumbrations" of what was past that, on apprehension of an object, or anything at all (eidetic or otherwise), gather to produce identity and knowledge. This general line of thought is Heidegger's contra Husserl, claiming the latter was "walking on water". This is picked up by Derrida, who coined "the metaphysics of presence". The solution lies with Kierkegaard's Concept of Anxiety. Kierkegaard saw that temporality subsumed the past-into-future dynamic. The real solution is this: past and future can only be In the eternal present, in and of and throughout, the unrealized present; unrealized because, and this becomes a major theme is the existentialism to come, in our everydayness we are naturally disposed ignore the present AS present, and we live in an inherited body of culture which fixates and dazzles our engagements.

Fascinating, really. I am reading Hegel now and everywhere I see Kierkegaard, and everywhere in Kierkegaard I see Sartre, Heidegger, and so on. But this doesn't advance my point.

The real issue lies in meta-aesthetics/ethics: what is the Good? Wittgenstein thought the Good was divinity, and I think this problematically right. Witt was very fond of Kierkegaard. My entrance into this issue begins with the concrete: that spear in my side and the pain it produces: this is not an interpretative construction of language, even though language brings its disclosure to "light". This pain/joy dimension of our existence is the existential essence of aesthetics. Dewey didn't talk like this, but he was right: the Real is an originary whole, cognitive, aesthetic, sensory, intuitive, that is in essence pragmatic. The understanding is pragmatic, I claim, which is why the aesthetic cannot be spoken (and Wittgenstein does not speak of it. Though, Witt was no pragmatist). It is a "presence" which is simply there.

Interesting how this works out. If you follow Heidegger, no foundation can exist, for hermenuetics resists such a thing (though he is attacked on this very idea). We take up the world "as" the interpretative meaning (and Derrida later saying these meanings are self referential in their Saussurian differences). I admit this is right, not to put too fine a point on it, but in aesthetics and ethics, there is value. Value is non cognitive; of course, as with all things, cognition "takes up" present pain or joy and the recognition of it in thought depends on this (accepting that we are agencies of thought) . The difference here is that these aesthic/ethical modes, if you will, "speak". They have a nature beyond what can be spoken, yet they speak undeniably, intuitively of what they are. This is a very different affair from say, some qualia, like Moore's color yellow.

Of course, these thoughts are a work in progress. Any contribution you can make would be appreciated.
Constance September 27, 2021 at 17:47 ¶ #601204
Quoting RussellA
With postmodernism, where anything can be art, then there cannot be good art or bad art. Then the well-known artwork A mail box in a lake is equal to the most prominent postmodernist works in the San Francisco Museum of Modern Art (badly named, however)

But in modernism, where art has been defined (albeit in more than one way), there can be good and bad art. Then a child's crayon sketch of a dog can never be the equal of a Rembrandt or Matisse.


Just to add: Rorty thought things could be reconciled pragmatically. I look at him like this: there are no absolutes for, in good old Hegelian fashion, all utterances contain their own contradiction, and for Rorty, this world is "made, not discovered" and the contradictions are essentially pragmatic. But it is in pragmatics that things get settled. Art may be an open concept, utterly, but it is grounded in the pragmatic authority of our times, our zeitgeist, if you will. Peirce has a "long run" view that Rorty had to dismiss, but I think Rorty believes that in the play of thought, irony, that is, some things comes out ahead of others in concepts like a successful society, a well structured social environment.
There was this essay by Simon Critchley which called him on this. Sound like Rorty wants to have his cake and eat it. too: Pragmatism holds NO favorites, and cares nothing for a well governed world.
Deleted User September 27, 2021 at 17:53 ¶ #601205
This user has been deleted and all their posts removed.
Deleted User September 27, 2021 at 18:07 ¶ #601206
This user has been deleted and all their posts removed.
praxis September 27, 2021 at 18:20 ¶ #601211
Quoting tim wood
I couldn't care less about what... the knowledgeable consider... because I can think for myself and I'm not a mindless herd animal.
— praxis
:vomit:

Yessir! That knowledge sir! Tried it once; didn't like it!


You're forced to alter what I say to make a point. :roll: I value knowledgeable people in general but when it comes to art I can tell if I like something, and no authority on earth can know what may offer an aesthetic experience, though they may know general principles. I'm the best authority on my own sensibilities. Any of us can recognize that we may lack sufficient knowledge of an art form to more fully appreciate it. Does an authority telling you that something has greater value than you think it does make you value it more? I imagine that it does.
Deleted User September 27, 2021 at 18:25 ¶ #601215
This user has been deleted and all their posts removed.
praxis September 27, 2021 at 18:33 ¶ #601217
Quoting tim wood
But as with tools, do you buy the better tool for the job or the one you like?


This is a poor analogy because, in art, liking (aesthetic experience) is the job.

Quoting tim wood
And does not education and knowledge inform that decision?


I don't think that aesthetic experience is something that you consciously decide to have or not have. Education and knowledge contribute to shaping our own experiences, of course.

Quoting tim wood
And don't confuse the offer of an experience with the experiencing of it.


I don't know what you mean.
Deleted User September 27, 2021 at 18:44 ¶ #601219
This user has been deleted and all their posts removed.
praxis September 27, 2021 at 18:50 ¶ #601223
Quoting tim wood
Sweet Jesus, no! If you think "liking" is the sine qua non of aesthetic experience, then you're living one (or two)-dimensionally in a multi-dimensional world.


Apparently, you live in whatever world the art authorities tell you to live in.

You're not being clear about liking and aesthetic experience. Can you elaborate to an extent that what you're trying to say becomes meaningful?
frank September 27, 2021 at 19:04 ¶ #601228
Quoting praxis
sometimes a letterbox is just a letterbox.


It's usually a mailbox.
Deleted User September 27, 2021 at 19:14 ¶ #601230
This user has been deleted and all their posts removed.
frank September 27, 2021 at 19:37 ¶ #601238
Pop September 27, 2021 at 20:40 ¶ #601263
Reply to praxis Good luck with it. I feel the gulf in our understanding is too wide to bridge.

I will leave you with a link to panpsychism which I mistakenly thought you might be familiar with, and this quote:

"Today in the United States we have somewhere close to four or five thousand data points on every individual ... So we model the personality of every adult across the United States, some 230 million people".
—?Alexander Nix, chief executive of Cambridge Analytica, October 2016.[1]

According to Sasha Issenberg, CA indicates that it can tell things about an individual he might not even know about himself.[17][79] - Wikipedia

BTW: The central element of a consciousness is that it is self organizing, and AI is not self organizing, at least not as yet!
Pop September 27, 2021 at 20:44 ¶ #601264
Quoting tim wood
:100: Worth several reads. The TPF education-in-a-paragraph.

As, for a simple example, with sonnets. There are - can be - good sonnets and bad, but before there can be good and bad, there has to be the thing itself as form, and it seems to be within the constraint of form that art arises.


:up: Thank you. Thank god somebody understands and agrees.
It has been a very lonely thread otherwise. :lol:
praxis September 27, 2021 at 21:04 ¶ #601273
Quoting tim wood
Either you already know what I mean or you do not.


Hmm, starting with the obvious. So far so good!

Quoting tim wood
Assuming you're being candid and honest, you do not know what I mean.


I do tell the truth at times, when the mood strikes me.

Quoting tim wood
Which is to say that for you, art is what you like and not what you do not like, thus the two identical.


Let me see if I've got this straight so far. I don't follow your meaning well enough to draw meaning from it, therefore, for me, liking and aesthetic experience are identical? Actually, I've read this several times and it's not clear if you mean that liking for me is identical to aesthetic experience or identical to art. Art and aesthetic experience are not synonymous, clearly, because we can have aesthetic experience in the absence of art.

Quoting tim wood
And that's as far as we can go.


Stay here if you must but I'll push on.

Quoting tim wood
But your view makes art completely subjective, which leads to someone else calling art what you don't, yet that on the basis of your own criterium you cannot call not-art (after all, they like it). Which in turn leads to absurdities such as art-for-me and art-for-you, but no art.


Art is a social construct and has no objective reality. Like money, without people, the finest ink drawings in the world would just be paper and ink with no value beyond paper and ink. It would have value for bugs, I guess, who could nibble on it. But getting back to sapiens, I don't understand your problem with the absurd. If someone were to offer me a million dollars in fake money for my car I would probably laugh, thinking something like, "Oh, how absurd! this fool offering something with no value for my car." But then if she were to asks me to look more closely at the money and it turned out that it was exquisitely hand-drawn unique bills with beautiful designs. I might recognize the art and realize that it may have more value than my beat-up old car.

Quoting tim wood
Nor is there any accounting for your changing your mind. It was art yesterday, but not today.


If someone calls something art I will automatically evaluate it as art, if it's not readily apparent. If it showed no sign of skill or design it could still be seen aesthetically. If the artist decides the next day that what they said was art the day before isn't art today that's fine with me, though I may disagree. If a knowledgeable art critic disagrees with me that's fine too.

Quoting tim wood
Further, the experience in question is either an experience of liking or an aesthetic experience. For you these must be the same thing.


You asked, "do you buy the better tool for the job or the one you like?." I like to think that I would buy the best tool for the job, and I usually do, for the most part, but I am influenced by aesthetics. In any case, I think you need to define what the job of art is for this to mean anything. For many art is merely an investment opportunity and its job is to appreciate in value, to make money. It can also be a status symbol and its job is to show higher status. More abstractly, art can promote shared beliefs and values, or demote others. Finally, there can be art for art's sake, and its job is merely to experience the aesthetic.

Quoting tim wood
Perhaps this, the difference between food that's good for you and food that is not.


Oh, I see now, the knowledgeable art authority will save us from getting a tummy ache. :lol:

It's true that many want to be treated like children.
Tom Storm September 27, 2021 at 21:07 ¶ #601276
Quoting praxis
I value knowledgeable people in general but when it comes to art I can tell if I like something, and no authority on earth can know what may offer an aesthetic experience, though they may know general principles. I'm the best authority on my own sensibilities.


I guess we're back to that familiar aphorism - "I don't know much about art, but I know what I like." I personally am comfortable with this even though I recognize there is a universe of contested critical assessment and theory (much of it tedious and doctrinaire) available to us to ponder over. The shorthand 'I know what I like' doesn't mean you need to limit yourself to decorative works that you find pretty. It means that you know when you are having an aesthetic experience that you appreciate - it might be confronting, exciting, shocking, captivating.



praxis September 27, 2021 at 21:11 ¶ #601277
praxis September 27, 2021 at 21:14 ¶ #601281
Quoting Pop
I feel the gulf in our understanding is too wide to bridge.


Supposedly your "long story" can bridge this gap. Just as I predicted this epic tale has not materialized.
Deleted User September 27, 2021 at 21:23 ¶ #601285
This user has been deleted and all their posts removed.
Pop September 27, 2021 at 21:26 ¶ #601287
Quoting RussellA
An object can only have value if first defined. An object defined as a ship that sinks on first entering the water can rightly be said to be no good as a ship. The same object defined as a submarine that sinks on first entering the water may rightly be said to be good as a submarine.

With postmodernism, where anything can be art, then there cannot be good art or bad art. Then the well-known artwork A mail box in a lake is equal to the most prominent postmodernist works in the San Francisco Museum of Modern Art (badly named, however)

But in modernism, where art has been defined (albeit in more than one way), there can be good and bad art. Then a child's crayon sketch of a dog can never be the equal of a Rembrandt or Matisse.


I think this definition, such as it is, holds for all art. I think most people would understand art is something like this. Of course whether somebody uses it will depend on whether they find it useful. I find it most useful in reviewing a body of work over a lifetime - how the art work reflects a chronological growth in thinking and understanding - this also holds for progress in art historically. The definition's validity is quite certain and scientific, and so can be used to argue what is good art and what is not, even in post modernism, though of course some would disagree - however, no matter how much they disagree, they can not invalidate the definition logically. As well as utility, there is a certain beauty in this, from my perspective anyway. :smile:
T_Clark September 27, 2021 at 21:32 ¶ #601293
Quoting Tom Storm
I guess we're back to that familiar aphorism - "I don't know much about art, but I know what I like." I personally am comfortable with this even though I recognize there is a universe of contested critical assessment and theory (much of it tedious and doctrinaire) available to us to ponder over. The shorthand 'I know what I like' doesn't mean you need to limit yourself to decorative works that you find pretty. It means that you know when you are having an aesthetic experience that you appreciate - it might be confronting, exciting, shocking, captivating.


There are things I like and things I know are high quality. Some of the things I like I like because they are high quality. Some of the things I like I like in spite of the fact that I know they are not high quality, e.g. Velveeta, Twizzlers, "I'm Henery the 8th I am" by Herman's Hermits. Some of the things I don't like I don't like in spite of the fact I know they are high quality, e.g. most jazz, most rap.

None of this is an argument against anything you've written. I think I'm trying to fit my own experience into your framework.
Pop September 27, 2021 at 21:32 ¶ #601294
Quoting praxis
Supposedly your "long story" can bridge this gap. Just as I predicted this epic tale has not materialized.


I gave you a link to panpsychism.

Quoting Pop
In panpsychism, consciousness is fundamental, and is the only thing anything ever expresses through it's form. Long story. So I know that if anything should ever be expressed, that it will be consciousness.


It seems, you just misunderstood what was stated. A refresher in panpsychism should fix this.
Tom Storm September 27, 2021 at 21:39 ¶ #601298
Quoting T Clark
None of this is an argument against anything you've written. I think I'm trying to fit my own experience into your framework.


Yep - I'm not saying I'm correct, just that this seems to work. It's always interesting how discussions of art generally end up in good versus bad. Generally we can't help what we like and anyone who can't happily enjoy 'highbrow' and 'lowbrow' together is probably missing out on being human.
praxis September 27, 2021 at 22:00 ¶ #601305
Quoting tim wood
There's the notion of pearls before swine. Do you distinguish yourself from swine?


It's from the New Testament. Religious authority distinguishing the in-group from the out-group, essentially, to promote group solidarity and control. This is exactly what I'm talking about. Freethinkers don't usually let themselves be lead like children.

Quoting tim wood
At your level - as I understand you - you like it, it's art; it's good. At mine, there's a Wow! involved. That art, as I understand it, has the power to summon in me that which is other to and better than me, to me.


Wow! is not good? The power to summon in you that which is other to and better than you is not good?

praxis September 27, 2021 at 22:13 ¶ #601310
Quoting Pop
Supposedly your "long story" can bridge this gap. Just as I predicted this epic tale has not materialized.
— praxis

I gave you a link to panpsychism.


You must have your own version because some of your claims don't seem to agree with it. Panpsychism seems to center on 'mind' and you focus on consciousness. There's obviously a difference between being conscious and not being conscious, and you seem to accept this difference. A mind doesn't need to be conscious, does it? Naturally, art is an expression of minds.



Pop September 27, 2021 at 22:40 ¶ #601316
Quoting praxis
Panpsychism seems to center on 'mind' and you focus on consciousness. There's obviously a difference between being conscious and not being conscious, and you seem to accept this difference.A mind doesn't need to be conscious, does it? Naturally, art is an expression of minds.


How is mind different to consciousness?

Quoting Pop
What is consciousness?

According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us. Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning

The singular thing that life is concerned with is to maintain and continue itself, and consciousness facilitates this. It is the one thing we are always expressing. We express it when making art, and it seems art's function is to express our consciousness when we personally cannot - to express it at its best, express it to many, and into the future.
— Pop

Since this definition, and due to a wonder about what consciousness is, I came to define consciousness as an evolving process of self organization. But I don't know what the source of self organization is.

**In science, self organization caused life, In systems theory self organization caused order in the universe. That art also expresses consciousness / self organization is quite a big deal - I think anyway.


praxis September 28, 2021 at 00:00 ¶ #601342
Quoting Pop
How is mind different to consciousness?


Being conscious is being awake and aware. A mind is more than simply being conscious. A mind requires an internal model of its environment and a model of itself itself to navigate its environment. It needs to have motivations or drives, such as the drives to feed and reproduce, or to make art.
Pop September 28, 2021 at 00:02 ¶ #601346
Quoting praxis
Being conscious is being awake and aware. A mind is more than simply being conscious. A mind requires an internal model of its environment and a model of itself itself to navigate its environment. It needs to have motivations or drives, such as the drive to feed or reproduce.


Are you conscious of your mind, or are you mindful of your consciousness?
praxis September 28, 2021 at 00:08 ¶ #601348
Reply to Pop

I’m conscious of some of my mental activity but not all, and I’m generally aware of how conscious I am, though I could suddenly become unconscious before having a chance to realize it.
Pop September 28, 2021 at 00:21 ¶ #601355
Quoting Pop
“Art is an expression of human consciousness. Art work is information about the artist’s consciousness.”


Quoting praxis
Naturally, art is an expression of minds.


I'm glad we agree. Consciousness is a little more accurate, imo. As it relates to a state of mind. It is a state of mind that is expressed in art, or anywhere.

The Oxford Living Dictionary defines consciousness as "The state of being aware of and responsive to one's surroundings.", "A person's awareness or perception of something." and "The fact of awareness by the "mind" of itself and the world." - wikipedia
praxis September 28, 2021 at 00:36 ¶ #601360
Quoting Pop
Consciousness is a little more accurate, imo. As it relates to a state of mind.


Right, the state of merely being conscious. In fact, it is less accurate because we know that much of mental activity, and perhaps especially creative work, is subconscious.

Quoting Pop
It is a state of mind that is expressed in art, or anywhere.


You mean like this?

User image

The state of being awake depicted in art by Leah Saulnier.

Not sure how this can be expressed anywhere. I guess Saulnier could go on tour.
Pop September 28, 2021 at 00:47 ¶ #601362
Reply to praxis You are not a bad artist, imo. Your philosophy could use a bit of work though :razz: Misunderstanding is hard to avoid in this setting. My expression needs work also. :sad:

The state of one’s mind at any particular time is one’s consciousness.

Nice work. You have some good ideas that I have seen here and there. I like the way you highlight the idea, rather than develop the aesthetic - the decorative aspect. Well done!
praxis September 28, 2021 at 01:52 ¶ #601371
Quoting Pop
The state of one’s mind at any particular time is one’s consciousness.


A meaningless statement since it’s only accounting for consciousness or whether a mind is conscious or unconscious. A mind can be in a dream state, for example, in which case the state of one’s mind is unconscious or lacks consciousness. It doesn’t account for motivation, feelings, mental representations, or anything that a mind is comprised of, merely whether or not its conscious.

Quoting Pop
the aesthetic - the decorative aspect

:roll:
Constance September 28, 2021 at 14:58 ¶ #601565
Quoting Pop
Yes, it possesses information about that affair, as you put it. It is entirely information about that affair.


You mean it "informs" which is does. But you are bypassing the point: That thing out there is not nor ever was independent of what is "in here"

Quoting Pop
Anything deemed to be art is art, end of enquiry. This is because we have a long history of this being the case, and the fact that art was thought to be indefinite.


Well, if THAT i what you think art is, you are starkly begging the question: what is it that art IS, such that when you call something art you have some property in mind? No property, no predication, then no meaning. Like saying, "Snow is W*&^$&@*." (Keeping in mind that yours is a definition of art, or, the art obejct.)
We have a long history of explaining what good government is, but this by no means tells us us we are finally right because history has been around all these years. It always has to be understood that philosophers are professional thinking people, and, as Hegel said, all propositions carry their own negation. The trick, I believe I mentioned, is to find a grounding for art that is not contingent of language. That is the aesthetic. Philosophers have PUT art in disarray, just as they chase everything around until exhaustion and absurdity rule. They do this because they will not admit foundational talk, and, I have to add, rightly so, because this is the death of free thought, dogmatism; BUT, the vagaries of art's definition do not mean there is no "presence" that is there. (A very interesting issue. Wittgenstein said ethics and aesthetics make impossible claims-- absolute claims! For value is not observable. This is why it is so hard to talk about it, well, meta-art issues. But: there is no mistaking the, call it, the ontologicality of good and bad. In art, imagine music or a painting that is so compelling, so affectively stirring, and the "aesthetic" is unmistakable. Without this, the music would be nothing. The aesthetic makes music, music. The same with all else. Remove this dimension of the experience, and the is no art, just talk

Talk, language, logic and cognition, is not AS SUCH, aesthetic. This is a prima facie resaon to dismiss the statement, Art is information. But then, your argument is that the art OBJECT is information, right? There is a big difference. But I say, the art object cannot be removed fromt he inner experience because this experience is not about something else, as with information, but IS that object, just as you cannot experience inwardly Van Gogh's Boots painting without an explicit reference to the object. This is different from, say, a letter sent INFORMING of something that has nothing at all to do with the medium of information: Good news that you won the lottery has nothing to do with those words on a page.

Art IS informed, transported from one to another through an information medium, most certainly. But the art work itself IS IN that which is informed. So the art object cannot be simply information.

Quoting Pop
As I have explained a number of times now - we cannot predict what art will be in its form, or what the experiential reaction to this form will be. These things are endlessly variable and open ended, so can not form part of any definition of art.

Hopefully this answers your question - yes an art work is information, and it is information about the consciousness of the artist. It exists in some form, and this form by virtue of being something physical is aesthetic, so is always experiential. But there is nothing definite about the form, or any resultant aesthetic, or experience. We can not predict what the form of art will be in a hundred years, or the experience that will result from it, so can not define art in these terms. These terms are variable, they do not always exist in art, and it is unpredictable how they might exist in future. For a definition, we need to focus on the things that always exist in art, and the only thing that always exist in art is that art work is information about the artists consciousness - everything else is variable! That is why this is a definition - such as it is. :grin:
— Pop

There is a limit to art however, and that limit is the artists thinking - an artist cannot make art about something that they cannot think about. So art is an expression of consciousness, and no more. It is not an expression of something beyond the consciousness of the artist - cannot possibly be. So is information about the consciousness of the artist, including the subconscious.


Some things here a bit odd: "by virtue of being physical is aesthetic"? But this says the physical is what produces the aesthetic. But if anything is aesthetic, it is not the object, but the subjective response to the object. The object is supposed to be merely "information" about the goings on in consciousness. Are you saying the aesthetic lies in the evocative powers of the object? But evocative brings in a new dimension to information that don't really hold: is what "informs" that which is evocative? This latter is more causative, isn't it? To inform means to possess X and to pass it along. Evoke is to inspire, motivate, cause. If an art work is evocative of something, it is not informing me, but eliciting something else within. Information is a troubling term here throughout. N
Nothing definite about the form? Why, what do you mean by "definite"? You mean, the "what it is" is indeterminate? But all things are this if you look to explanatory affairs exclusively, for you are deep in metaphysics now and are simply denying absolutes, and this is a point of contention. I cannot SAY what being in love ism for language does not speak the world, does not say the ISness about the presences encountered, which leads to the post Heidegger world of postmodern thinking. But in aesthetic and ethics, therein lies true presence. A highly debatable issue. Postmodern thinking is right on the money in much I have read; but when value is brought before it, it falls flat.

I cannot understand this at all:
This is For a definition, we need to focus on the things that always exist in art, and the only thing that always exist in art is that art work is information about the artists consciousness - everything else is variable!

Frankly, just the opposite is the case. Information is interpretative, for all meanings are indeterminate. It is the aesthetic that remains after all talk is done. Wittgenstein held this, and he was right, only wrong about his strict line of what was allowable in meaningful speech (in the Tractatus, that is).

Finally all this remains blind to the artwork's inextricable presence in experience: the symphony is not a vehicle of aesthetic information, for the artwork IS the experience. See the above.



RussellA September 28, 2021 at 16:50 ¶ #601590
Quoting Constance
for Rorty, this world is "made, not discovered"


Sentient life is not just an observer of the world but is a part of the world

The human observer does not lead an existence separate to the world. The human is an integral part of the world, and has been part of an evolutionary process stretching back at least 3.7 billion years - a synergy between all parts of the physical world, of matter and force, between nature and life.

IE, the human is not an outside observer of the world, but part of the world.

The pragmatist view is only half the story

The pragmatist holds the position that the purpose of our beliefs as expressed in language is not to understand the true nature of reality existing on the other side of our senses, but to succeed in whatever environment we happen to find ourselves. As with Kant's synthetic a priori, we make sense of the world by imposing our a priori concepts onto the world we observe

However, the human observer does not have a separate existence to the reality of any world external to their senses, but is an intrinsic part of reality. The observer is part of the world and the world is part of the observer, they are one and the same.

As the observer is part of reality, then any beliefs the observer has about the reality of logic, aesthetics, ethics, space, time, etc must also be an inherent part of reality itself.

Rather than we make sense of a reality external to our senses by imposing our a priori concepts onto it, part of reality makes sense of itself through a priori concepts.

IE, the pragmatist holds the position that the human observer only has an indirect contact with reality through the senses, whereas in fact, the human observer's knowledge also comes from being in direct contact with reality, being an intimate part of reality.

The question as to whether the aesthetic exists in the object observed the other side of the sense or within the observer disappears, as the reality on the other side of the senses is the very same reality as within the observer, in that there is only one reality. The aesthetic within the world and the aesthetic within the observer are one and the same, as any aesthetic in the sentient life is exactly the same as the aesthetic in the world from which it evolved over billions of years. IE, The word "aesthetic" only exists within human language, which only exists within humans, which exist within the world, meaning that "aesthetics" must exist in a world within which humans exist.

As I see it, the aesthetic is an abstract expression of the human ability to discover pattern in seemingly chaotic situations, to discover uniformity in variety, an invaluable trait in evolutionary survival. As Francis Hutcheson wrote in 1725: “What we call Beautiful in Objects, to speak in the Mathematical Style, seems to be in a compound Ratio of Uniformity and Variety; so that where the Uniformity of Bodys is equal, the Beauty is as the Variety; and where the Variety is equal, the Beauty is as the Uniformity”.

For me, important visual art requires aesthetic form of pictographic representation. As expressed by Hegel, formal quality is the unity or harmony of different elements in which these elements are not just arranged in a regular, symmetrical pattern but are unified organically together with a content of freedom and richness of spirit (though for me not a content of the divine).

Summary

In summary, the pragmatists are making the mistake of not taking into account the fact that because we are in intrinsic part of the world, this world "is also discovered, as well as made".
Pop September 28, 2021 at 21:04 ¶ #601673
Quoting praxis
The state of one’s mind at any particular time is one’s consciousness.
— Pop

A meaningless statement since it’s only accounting for consciousness or whether a mind is conscious or unconscious.


It means you can not separate mind and consciousness. That consciousness is a state of mind.
The subconscious likewise is always an aspect of consciousness, so is not something separate.

Quoting praxis
A mind can be in a dream state, for example, in which case the state of one’s mind is unconscious or lacks consciousness. It doesn’t account for motivation, feelings, mental representations, or anything that a mind is comprised of, merely whether or not its conscious.


I fail to see how this is relevant, since you are not going to be making art in your sleep?
Whilst you are awake, you are conscious. Consciousness represents your current state of mind and this is what you express, no? Yes you have feelings, opinions, etc, and what you express is your current state of mind about these - which is your consciousness. In a fit of rage, you are not going to express something peaceful and serene, are you? Consciousness is not merely whether you are conscious or unconscious - it is the current state of one's mind.
Tom Storm September 28, 2021 at 21:55 ¶ #601679
Quoting Pop
Yes you have feelings, opinions, etc, and what you express is your current state of mind about these - which is your consciousness.


No, the unconscious may well direct artistic choices and the artist may have little or no capacity to access what the work is expressing. Certainly there are schools of psychology that would hold to this, such as the psychoanalytical school. The artist may have little or no insight into their artwork. I've known enough painters, sculptors and writers to understand that often they are producing works without having the slightest idea why choices are made - it may well be all about their own suppressed childhood or traumas but this may not be known to them or readily obvious in the work.

Quoting Pop
In a fit of rage, you are not going to express something peaceful and serene, are you?


Wrong. You may well do just this as a wish fulfillment state. There are angry artists who paint or write mellow and gentle works. I've met them. The opposite can also be true. The idea that a work of art will express the emotional state of an artist is naïve. Often art is an expression of unconscious desires or beliefs or may be deliberate constructions which are attempts to build an alternative reality as a consolation.
praxis September 28, 2021 at 22:20 ¶ #601687
Quoting Pop
I fail to see how this is relevant, since you are not going to be making art in your sleep?


It's a mental state where consciousness is absent. Also, many artists are inspired by dreams and intuition so you can't say that creative or artistic work is entirely conscious.

Quoting Pop
The subconscious likewise is always an aspect of consciousness, so is not something separate.


A dream state is subconscious or a state of mind where consciousness is absent.

Quoting Pop
Yes you have feelings, opinions, etc, and what you express is your current state of mind about these - which is your consciousness.


It's not as straightforward as you seem to think it is. To a large extent, the human mind can be seen as little more than a prediction machine, and the conscious mind is a kind of guide or rationalizer for that conditioned machine. We react to things according to our conditioning and the conscious mind rationalizes and develops its narrative after the fact.

Quoting Pop
Consciousness is not merely whether you are conscious or unconscious - it is the current state of one's mind.


Which is either conscious or unconscious when referring specifically to consciousness. When a surgeon enters an operating theatre and checks on the status of the patient, does he ask the aesthetician "What's the patient's current state of mind?" or does he ask "Is the patient unconscious?" He asks something like the latter because that's specifically his concern.

Note: you're going to continue endlessly repeating yourself until you sort out, or acquire, ideas (metaphysical?) about consciousness.

Pop September 28, 2021 at 22:21 ¶ #601688

Quoting Constance
You mean it "informs" which is does. But you are bypassing the point: That thing out there is not nor ever was independent of what is "in here"


When information informs you, it changes your neural state such that you ultimately have an experience.

Quoting Constance
imagine music or a painting that is so compelling, so affectively stirring, and the "aesthetic" is unmistakable. Without this, the music would be nothing. The aesthetic makes music, music. The same with all else. Remove this dimension of the experience, and the is no art, just talk


Nobody is saying experience is not part of the equation, what I am saying is that it is indefinite.
Aesthetics and experience is endlessly variable and open ended! So art can not be defined in terms of it.
In any case the term consciousness already encompasses the experiential aspect of mind that it represents.

Quoting Constance
Art IS informed, transported from one to another through an information medium, most certainly. But the art work itself IS IN that which is informed. So the art object cannot be simply information.


Yes an art object IS simply information. This information then informs the viewer, and an experience is had. Information is something far more powerful then it is normally understood to be, a bit much to unload here, but there are other threads open, as previously mentioned.

Quoting Pop
As I have explained a number of times now - we cannot predict what art will be in its form, or what the experiential reaction to this form will be. These things are endlessly variable and open ended, so can not form part of any definition of art.


Quoting Constance
The object is supposed to be merely "information" about the goings on in consciousness. Are you saying the aesthetic lies in the evocative powers of the object? But evocative brings in a new dimension to information that don't really hold: is what "informs" that which is evocative?


The viewer experiences the art work in a Enactivist fashion, where the consciousness of the viewer and the form of the art work, interact to cause an experience. The experience is not entirely the result of the artwork, nor entirely the result of the viewer, but is an amalgam of the two - experienced by the viewer. In the best of cases, these two gel to cause a pleasant experience, rather than repel, which would be an unpleasant experience, or one that is bypassed altogether.







Pop September 28, 2021 at 22:29 ¶ #601691
Quoting Tom Storm
No, the unconscious may well direct artistic choices


Quoting Pop
It means you can not separate mind and consciousness. That consciousness is a state of mind.
The subconscious likewise is always an aspect of consciousness, so is not something separate.


Quoting Tom Storm
In a fit of rage, you are not going to express something peaceful and serene, are you?
— Pop

Wrong. You may well do just this as a wish fulfillment state. There are angry artists who paint or write mellow and gentle works.


Sure angry people can be mellow and gentle at times, but In a fit of rage, all they will express is a fit of rage. :lol: In any case, what they express is their state of mind - which is their consciousness.
Pop September 28, 2021 at 22:35 ¶ #601696
Quoting praxis
It's a mental state where consciousness is absent. Also, many artists are inspired by dreams and intuition so you can't say that creative artistic work is entirely conscious.


Do you or anybody you know make art in your sleep? Whilst artists make work about dreams, they do not do so whilst they are asleep. These are conscious thoughts about states of unconsciousness.

Quoting praxis
Which is either conscious or unconscious when referring specifically to consciousness.
:roll: You are trolling - surely?
Tom Storm September 28, 2021 at 22:38 ¶ #601698
Quoting Pop
Sure angry people can be mellow and gentle at times, but In a fit of rage, all they will express is a fit of rage.


Untrue. For years I have worked with prisoners and people with vast anti-social behaviors. A fit of rage may be suppressed. What you say only applies if they are acting out. A person's emotional state need not influence on their work unduly.

Quoting Pop
n any case, what they express is their state of mind - which is their consciousness.


You still have not answered why using the word consciousness matters and how this is different to an artist expressing their 'personality'. What does this word consciousness mean for art? Everything we do is consciousness if you want. So by definition taking a shit and painting are both produced by same thing. How does it benefit an understanding of art to use this word? You might as well say all art is life. Because all artists are alive when they work.

Pop September 28, 2021 at 22:52 ¶ #601701
Quoting Tom Storm
A fit of rage may be suppressed.


So what is expressed - is it not the current state of mind?

Quoting Tom Storm
You still have not answered why using the word consciousness matters and how this is different to an artist expressing their 'personality'.


Quoting Pop
According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us.Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning
T_Clark September 28, 2021 at 22:58 ¶ #601703
Quoting Tom Storm
I've known enough painters, sculptors and writers to understand that often they are producing works without having the slightest idea why choices are made - it may well be all about their own suppressed childhood or traumas but this may not be known to them or readily obvious in the work.


I don't think it reflects anything pathological. I'm a really verbal person, not particularly visual. I'm pretty good at explaining my decisions, feelings, imaginings, etc... There are a lot of people who are just not that way. I would imagine that many visual artists and musicians are not very self-aware in a verbal way. Many of them are probably also not good with words. On the other hand, they see and hear things I never do.
praxis September 28, 2021 at 23:16 ¶ #601707
Quoting Pop
Which is either conscious or unconscious when referring specifically to consciousness.
— praxis

:roll: You are trolling - surely?


When someone asks if you’re awake (conscious) do you tell them your state of mind? No, you answer affirmatively. If someone asks how you’re feeling do you say, “I feel conscious.”?
frank September 28, 2021 at 23:21 ¶ #601708
Quoting praxis
If someone asks how you’re feeling do you say, “I feel conscious.”?


From now on I will.
Tom Storm September 28, 2021 at 23:24 ¶ #601709
Quoting T Clark
I don't think it reflects anything pathological.


You're right. I was just providing trauma as a potential example. But I do think people's life experiences and childhoods (awful or otherwise) play a bigger role in artistic choices than we often think.
Tom Storm September 28, 2021 at 23:27 ¶ #601710
Reply to Pop Sorry man, it all seems empty of content. Taking a dump/painting = same thing. It adds nothing to our understanding of art.

Quoting Pop
So what is expressed - is it not the current state of mind?


Probably the artist's projected will. To say it is their state of mind would be close to meaningless.
Pop September 29, 2021 at 00:03 ¶ #601721
Quoting praxis
When someone asks if you’re awake (conscious) do you tell them your state of mind?


What else can you possibly do other then express your state of mind. An answer of affirmative = your state of mind!

Consciousness is not simply consciousness or unconsciousness.

Quoting Pop
According to American philosopher John Searle: “Consciousness is that thing that presents itself as we wake up in the morning and lasts all day until we go back to sleep again at night.” It isn’t simply awareness or knowledge – I believe Carl Jung would agree that to every bit of consciousness is attached 100 bits of the subconscious, interwoven into a mental lattice presenting as a united front. It is fundamental to us.Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning


How about reading some of this before you pose another question?
Pop September 29, 2021 at 00:07 ¶ #601722
Quoting Tom Storm
?Pop Sorry man, it all seems empty of content. Taking a dump/painting = same thing. It adds nothing to our understanding of art.



Quoting Pop
Consciousness is personality in action, yet we are hardly aware of it. Modern science has not been able to pin consciousness down, however panpsychism and eastern philosophy agree that consciousness is a fundamental property of the universe - from this perspective consciousness takes on a much deeper meaning

 The singular thing that life is concerned with is to maintain and continue itself, and consciousness facilitates this. It is the one thing we are always expressing. We express it when making art, and it seems art's function is to express our consciousness when we personally cannot - to express it at its best, express it to many, and into the future.


Quoting Pop
A definition of art,and I’m not saying my definition is necessarily it, has the potential to shift the power balance in the art world, back into the hands of the intellectuals and the artists. This is my primary goal. It is a long shot indeed! but what is there to loose? it is worth a try, imo.

The definition is useful in these potential ways rather then as something providing clarity about art, or the art world today - whose clarity, and integrity, at present, as you may know, was recently well represented by a banana nailed to the wall.

Tom Storm September 29, 2021 at 00:32 ¶ #601729
Quoting Pop
A definition of art,and I’m not saying my definition is necessarily it, has the potential to shift the power balance in the art world, back into the hands of the intellectuals and the artists. This is my primary goal. It is a long shot indeed! but what is there to loose? it is worth a try, imo.

The definition is useful in these potential ways rather then as something providing clarity about art, or the art world today - whose clarity, and integrity, at present, as you may know, was recently well represented by a banana nailed to the wall.


I like the idea of this but I can't yet see how it would work. Sorry.

Can you perhaps, using some brief dot points and a given work, step it out for us so we can see it in action?

Even if the 'art world' accepted the idea that art is consciousness, what difference would it make in practice? They already mostly accept that art is the personality of the artist.

I still can't see the use of this in action.

Pop September 29, 2021 at 00:57 ¶ #601738
Quoting Tom Storm
I like the idea of this but I can't yet see how it would work. Sorry.


It may not work. In fact it is highly unlikely that it will work. However, what is there to lose?

Quoting Tom Storm
Can you perhaps, using some brief dot points and a given work, step it out for us so we can see it in action?


You are seeing it in action now. The logic of the definition prevails, despite widespread disapproval.
praxis September 29, 2021 at 02:51 ¶ #601757
Quoting Pop
When someone asks if you’re awake (conscious) do you tell them your state of mind?
— praxis

What else can you possibly do other then express your state of mind. An answer of affirmative = your state of mind!


Yay! :party:
Tom Storm September 29, 2021 at 04:43 ¶ #601774
Quoting Pop
It may not work. In fact it is highly unlikely that it will work. However, what is there to lose?


Ok
praxis September 29, 2021 at 16:45 ¶ #601924
Quoting Pop
... if we had a definition of art, then our understanding of art would self-organize around the definition.


That's not how labels or signs and meaning work, is it? If I define myself as an astronaut it will be meaningless because I've never trained to be an astronaut and have never been to space. If we change the definition of an astronaut to 'a person who is trained to travel underwater' we'll still need a word for people who are trained to travel in space. Suggesting that the definition of art can be so readily shifted only underscores its nature of being a social construct and subject to the whims of culture and speculative value.

A definition of art, and I’m not saying my definition is necessarily it, has the potential to shift the power balance in the art world, back into the hands of the intellectuals and the artists. This is my primary goal.


What is the basis of the power of those who control the art world today? Wealth and influence basically, right? If I intuit (you don't lay it out explicitly) your plan, you want to somehow imbue art with a kind of pseudo-religious meaning and in that way empower it. Near the OP, which I finally just read, you write:

Panpsychism and Buddhism are the only complete theories of consciousness we have. They both suggest consciousness is a fundamental property of the universe. From this perspective, consciousness takes on a much deeper meaning.


This also explains your curious issue with 'art for art's sake' or art for aesthetic experience. You find aesthetics trivial or mere decoration, apparently. Anyone concerned with power and influence naturally would.

Your definition of art is necessarily ambiguous because the basis of power in a pseudo-religious fantasy art world would be the same as that of religion, faith in the authority, and the authority dictates meaning that they have special access to and which others do not.


T_Clark September 29, 2021 at 16:46 ¶ #601925
Quoting praxis
When someone asks if you’re awake (conscious) do you tell them your state of mind? No, you answer affirmatively. If someone asks how you’re feeling do you say, “I feel conscious.”?


Whenever you talk about consciousness, the fact that different people mean different things by the word always gets in the way.
Constance September 29, 2021 at 18:16 ¶ #601941
Quoting RussellA
Sentient life is not just an observer of the world but is a part of the world

The human observer does not lead an existence separate to the world. The human is an integral part of the world, and has been part of an evolutionary process stretching back at least 3.7 billion years - a synergy between all parts of the physical world, of matter and force, between nature and life.

IE, the human is not an outside observer of the world, but part of the world


And Rorty would agree with you, as long as you are not stepping into metaphysics. His pragmatism, at the level of basic questions, agrees with Heidegger, Wittgenstein and Dewey (and Khun, his favorites for the 20th century). Science is unassailable in the language and pragmatic affairs that make our world work. But just don't think science has some grasp on the things foundationally: Even a LITTLE, don't think this. This is nonsense for him, for all things are, at this level, pragmatic constructions. Evolution, at this level, says nothing, and claims that it does is just bad metaphysics.

Most are not inclined to go this far.

Quoting RussellA
The pragmatist holds the position that the purpose of our beliefs as expressed in language is not to understand the true nature of reality existing on the other side of our senses, but to succeed in whatever environment we happen to find ourselves. As with Kant's synthetic a priori, we make sense of the world by imposing our a priori concepts onto the world we observe

However, the human observer does not have a separate existence to the reality of any world external to their senses, but is an intrinsic part of reality. The observer is part of the world and the world is part of the observer, they are one and the same.


But then, when you are pressed to say what world is that you are a part of, you re referred back to the self, same as Kant. The question about all this really lies with metaphysics, good or bad? Bad metaphysics extends theory beyond what can be "witnessed" (challenging here the positivists), but good metaphysics asks, what is there in what is witnessed that gives rise to metaphysics at all? Your "observer is part of the world" goes to this, for to speak of a world of which we are a part is to speak of something not witnessable, like a chair or a pen: the world is not a particular, but nor is it general concept. Life gets a little spooky, or it should, at this point. Most philosophers don't see it this way, holding a reductive view of "the world" to this or that identifiable category. Husserl to Levinas makes sense of this for me.

Anyway, keep in mind that the Tractatus Wittgenstein would throw up red flags to expressions like "part of the world" for world's opposite here cannot even be imagined. Thoughts draw limits, and no limit can be seen. (I have always thought this threshold itself was the nonsense, though. Metaphysics is In the physics, if you will.)

And finally, the whole matter collapses into triviality regarding ethics and aesthetics, if nothing can be affirmed at this level.

Quoting RussellA
As the observer is part of reality, then any beliefs the observer has about the reality of logic, aesthetics, ethics, space, time, etc must also be an inherent part of reality itself.


I agree with this. But I don't think we have the same views on it.

Quoting RussellA
Rather than we make sense of a reality external to our senses by imposing our a priori concepts onto it, part of reality makes sense of itself through a priori concepts.

IE, the pragmatist holds the position that the human observer only has an indirect contact with reality through the senses, whereas in fact, the human observer's knowledge also comes from being in direct contact with reality, being an intimate part of reality.


That is a sticky wicket you just said. There is a good reason Rorty and others deny that knowledge can in any way align with "reality" at the foundational level. The reason is that it seems impossible to remove from what we know the means of knowing itself. This is why analytic philosophers are so bad at epistemology: Affirming (believing, knowing) P, by S, never gets beyond justification. This means the "aboutness" of P is entirely lost unless you can make that essential "connection" between knower and known. All claims to some "objective" world independent of justification simply falls away. 'Objective' simply becomes part of the whole, as you say below.
But this doesn't mean there is no way to affirm the Real in an absolute sense (my sticky wicket): it is affirmed through value, the interest, caring, affect,desire, enjoying, suffering, and on and on. This is the only dimension of judgment that survives the failure of the terms of justification, because, while it is delivered in language (pragmatically construed, contingent), it has a determinacy that is not a construct of language. This is the issue for metaethics, meta aesthetics, metavalue: the noncontingent Good and the Bad. What IS music's affect?

And this "partial contact with Reality" will not hold water with the likes of Rorty, Dewey, or anyone else. Such a reality is, as with all things, a pragmatic construction, future looking in an anticipated response, the truth being the consummatory conclusion. It is a hard pill to swallow for most, but we live in pragmatic Time, events, and Being/Reality is just a vacuous construction in the matter of ontology. To call something partial implies the whole to make sense. It doesn't.

Quoting RussellA
The question as to whether the aesthetic exists in the object observed the other side of the sense or within the observer disappears, as the reality on the other side of the senses is the very same reality as within the observer, in that there is only one reality. The aesthetic within the world and the aesthetic within the observer are one and the same, as any aesthetic in the sentient life is exactly the same as the aesthetic in the world from which it evolved over billions of years. IE, The word "aesthetic" only exists within human language, which only exists within humans, which exist within the world, meaning that "aesthetics" must exist in a world within which humans exist.

As I see it, the aesthetic is an abstract expression of the human ability to discover pattern in seemingly chaotic situations, to discover uniformity in variety, an invaluable trait in evolutionary survival. As Francis Hutcheson wrote in 1725: “What we call Beautiful in Objects, to speak in the Mathematical Style, seems to be in a compound Ratio of Uniformity and Variety; so that where the Uniformity of Bodys is equal, the Beauty is as the Variety; and where the Variety is equal, the Beauty is as the Uniformity”.


The "other side" is noumenal impossibility if you're talking about what is left when all experience making faculties leave the room. But then, there is this side, the Cartesian center fomr which all meaning issues. Not observable in the usual sense, but philosophy cares nothing for the usual sense, or shouldn't. Not so much as the cogito as a transcendental locus of intuitive disclosure. Meanings emerge here.

There is no billions of years to measure things at this level of analysis. Evolution, physics, and all empirical science are out the window. This is now phenomenology. But I agree completely that "aesthetics exists in (the) world". Itis simply arbitrary to localize human affairs apart from the whole. But the question then lies with how to determine where the center is to all this. Science is dethroned, and meaning (as Heidegger said) is front and center. A new ontological hierarchy, and Rorty is on board, as am I. Evolution has always been uninformative, anyway, for it could never explain meaning, aesthetic, ethical. Dictionary meanings? Somewhat.

As to Beauty, I don't think, frankly, Hutcheson had a clue, for all that is said to account for beauty, lacks the very element of the beautiful. It is like emergent qualities theory: X emerges from Y, where Y is qualitatively absent of X. Senseless. The aesthetic is "its own presupposition". It is simple, unanalyzable. Value is this, which is why Wittgenstein would never talk about it. Nothing to say. He was wrong on that account.

Quoting RussellA
For me, important visual art requires aesthetic form of pictographic representation. As expressed by Hegel, formal quality is the unity or harmony of different elements in which these elements are not just arranged in a regular, symmetrical pattern but are unified organically together with a content of freedom and richness of spirit (though for me not a content of the divine).

Summary

In summary, the pragmatists are making the mistake of not taking into account the fact that because we are in intrinsic part of the world, this world "is also discovered, as well as made".



Yes, that part about the divine is important, though. The artwork is a mirror of the spirit, for Hegel, and the aesthetic discovered therein is metaphysical. The meta aesthetic question is the only one there is at the basic level. I think Hegel is right about this (though I won't be winning many friends on this point. People don't think this is intellectually responsible talk. But call them on this, and they can't defend it.)












Pop September 30, 2021 at 01:17 ¶ #602043
Quoting praxis
Suggesting that the definition of art can be so readily shifted only underscores its nature of being a social construct and subject to the whims of culture and speculative value.


I would agree that the future prospects of the definition are uncertain. It's strength is, I believe, that it identifies in scientific terms something that is a constant feature of art. It is not so much that this is something new that causes a change, but rather is something that highlights the main element of art, which in general has been denied by postmodernism.

Quoting praxis
Your definition of art is necessarily ambiguous because the basis of power in a pseudo-religious fantasy art world would be the same as that of religion, faith in the authority, and the authority dictates meaning that they have special access to and which others do not.


I think you misconstrue me entirely. Panpsychism is not religious, and neither is Yogic logic. I used Buddhism as it is generally more recognizable. I only had a superficial understanding of consciousness at the time of writing the definition. I have since spent almost two years gaining a better, more scientific, insight. It turns out information has a lot to do with consciousness - consciousness is a state of integrated information in IIT, and a reinterpretation of information as something fundamental is a current concern in all the disciplines. In respect to art, the only question that remains is - information about what? And what else can it be other then consciousness? Simply put consciousness is a state of mind about how we understand ourselves in the world that we live in. But it is a concept that spans everything, so way outside the scope of this post.

Ideally the definition should be seen as conceptual art. An art piece depicting a scientific and irreducible definition of art. It is logically unassailable, so this makes it interesting. It is a challenge to the status quo, of art for art's sake, so anybody wishing to challenge the status quo can use it if they wish. Will anybody use it? "hard to see the future is" - Yoda. :smile:
praxis September 30, 2021 at 02:49 ¶ #602064
Quoting Pop
It's strength is, I believe, that it identifies in scientific terms something that is a constant feature of art.


How is claiming that consciousness is a constant feature of art scientific?

Quoting Pop
I think you misconstrue me entirely. Panpsychism is not religious, and neither is Yogic logic. I used Buddhism as it is generally more recognizable. I only had a superficial understanding of consciousness at the time of writing the definition. I have since spent almost two years gaining a better, more scientific, insight. It turns out information has a lot to do with consciousness - consciousness is a state of integrated information in IIT, and a reinterpretation of information as something fundamental is a current concern in all the disciplines. In respect to art, the only question that remains is - information about what? And what else can it be other then consciousness? Simply put consciousness is a state of mind about how we understand ourselves in the world that we live in. But it is a concept that spans everything, so way outside the scope of this post.


Well now, you spent two years gaining insight so you must be something of an authority. What did I just say??? This is exactly what I'm talking about. Consciousness woo woo!

Quoting Pop
It is a challenge to the status quo, of art for art's sake, so anybody wishing to challenge the status quo can use it if they wish.


Your goofy plan isn't a challenge to anything. You can't even convince some randos on an internet philosophy forum, some of whom might be quite gullible.
Pop September 30, 2021 at 02:58 ¶ #602066
Quoting praxis
Your goofy plan isn't a challenge to anything. You can't even convince some randos on an internet philosophy forum, some of whom might be quite gullible.


Quoting Pop
Ideally the definition should be seen as conceptual art. An art piece depicting a scientific and irreducible definition of art. It is logically unassailable, so this makes it interesting. It is a challenge to the status quo, of art for art's sake, so anybody wishing to challenge the status quo can use it if they wish. Will anybody use it? "hard to see the future is" - Yoda. :smile:


Quoting praxis
How is claiming that consciousness is a constant feature of art scientific?


I give up on you. Good luck with it.
praxis September 30, 2021 at 03:00 ¶ #602067
Quoting Pop
How is claiming that consciousness is a constant feature of art scientific?
— praxis

I give up


Of course you do, “science” is too hard to explain. :razz:
baker September 30, 2021 at 05:46 ¶ #602105
Quoting T Clark
I don't think it reflects anything pathological. I'm a really verbal person, not particularly visual. I'm pretty good at explaining my decisions, feelings, imaginings, etc... There are a lot of people who are just not that way. I would imagine that many visual artists and musicians are not very self-aware in a verbal way. Many of them are probably also not good with words. On the other hand, they see and hear things I never do.

I see many art works as actually dealing with philosophical problems, but the artists themselves and their audience often don't see it that way.

In many ways, art is a kind of indirect, intuitive way of addressing philosophical (existential) problems.

Of course, there are artists who are specifically interested in philosophical problems and are able to formulate them in philosophical terms, but they also produce art works on those same themes, given that art works can sometimes allow for a succint handling of a philosophical problem the way a text/syllogism cannot.


Quoting Tom Storm
But I do think people's life experiences and childhoods (awful or otherwise) play a bigger role in artistic choices than we often think.

I had a literature teacher who said that a happy person cannot make art.
baker September 30, 2021 at 05:51 ¶ #602107
Quoting praxis
... if we had a definition of art, then our understanding of art would self-organize around the definition.
— Pop

That's not how labels or signs and meaning work, is it?


They do work that way, when it comes to things like art, culture, society, religion. These terms don't work the way a term like "table" or "astronaut" do.
baker September 30, 2021 at 06:12 ¶ #602110
Quoting praxis
I don't think that aesthetic experience is something that you consciously decide to have or not have. Education and knowledge contribute to shaping our own experiences, of course.

Education can also systematically destroy a person's trust in their own experience.

Quoting praxis
when it comes to art I can tell if I like something, and no authority on earth can know what may offer an aesthetic experience, though they may know general principles. I'm the best authority on my own sensibilities.

This is what they make a point of beating out of a person in the course of education. Of course, this can also happen subversively in that the person is taught a certain system of values and then made to believe it is their own.

As far as art is concerned, if there is one thing that I have learned best in my course of education is to dismiss my own sense of what would make an aesthetic experience for me.

While I do have certain thoughts and feelings coming up when beholding a work of art, my first impulse after that is insecurity, and the thought "Wait, but what would my betters, the authorities say about this -- do they consider this piece of work good or not, do they consider it art or not?"
baker September 30, 2021 at 06:13 ¶ #602111
Quoting tim wood
Sweet Jesus, no! If you think "liking" is the sine qua non of aesthetic experience, then you're living one (or two)-dimensionally in a multi-dimensional world.

Liking helps. It may even be the price of admission. But it's not the thing itself.


Indeed. My teachers always frowned upon liking.
baker September 30, 2021 at 06:27 ¶ #602112
Quoting praxis
Right, the state of merely being conscious.


Quoting Pop
I'm glad we agree. Consciousness is a little more accurate, imo. As it relates to a state of mind. It is a state of mind that is expressed in art, or anywhere.


I think Pop means conscious in the sense of "conscious of X".

It's not a commonly used formulation, but a very basic one, so much so that it seems redundant; so mundane that it can easily be overlooked.


Quoting Tom Storm
Even if the 'art world' accepted the idea that art is consciousness, what difference would it make in practice? They already mostly accept that art is the personality of the artist.

[i]Art is consciousness of beauty.
Art is consciousness of truth.[/i]

Doesn't the art world at least implicitly operate with such notions?
baker September 30, 2021 at 06:37 ¶ #602114
Quoting Tom Storm
Even if the 'art world' accepted the idea that art is consciousness, what difference would it make in practice? They already mostly accept that art is the personality of the artist.

Not as far as I know. High art, art proper, has always been about suprapersonal truths, ie. universal truths.

Tying an art work specifically to its author is characteristic of popular art or low art, or a populistic (plebeian) approach to art.

In art proper, one doesn't express oneself, one expresses a higher truth.
Tom Storm September 30, 2021 at 07:05 ¶ #602123
Reply to baker I think the cult of the artist as genius and visionary has almost always run alongside highbrow art too - whether you're talking Rembrandt, Wagner or Leonardo.

Quoting baker
In art proper, one doesn't express oneself, one expresses a higher truth.


I think the idea is that in a particular work we see personality interacting with the great and universal themes. I am not a great appreciator of the arts, so the issue is moot.
TheMadFool September 30, 2021 at 12:14 ¶ #602178
Quoting praxis
AI
Quoting Pop
art


Quoting Pop
Art is an expression of human consciousness




1. Is AI conscious & human?

OR

2. Is something wrong with your definition Pop?

praxis September 30, 2021 at 15:01 ¶ #602220
Quoting baker
They do work that way, when it comes to things like art, culture, society, religion. These terms don't work the way a term like "table" or "astronaut" do.


I could have sworn that I said something like “Suggesting that the definition of art can be so readily shifted only underscores its nature of being a social construct and subject to the whims of culture and speculative value.” Oh yeah, I did write that.

T_Clark September 30, 2021 at 15:39 ¶ #602231
Quoting baker
I see many art works as actually dealing with philosophical problems, but the artists themselves and their audience often don't see it that way.


If the artists and audience don't see it, maybe it comes from you. That's not a criticism. The experience of art includes how it fits in with the rest of our experience.
T_Clark September 30, 2021 at 15:53 ¶ #602234
Reply to TheMadFool

Both these paintings are done by elephants:

User image

User image
praxis September 30, 2021 at 16:12 ¶ #602239
I visited the Louvre once and out of the dizzying amount of painting you couldn’t get within 10 yards of the Mona Lisa because of all the people crowded around it. Elephant art really stands apart.
T_Clark September 30, 2021 at 16:28 ¶ #602243
Quoting praxis
Elephant art really stands apart.


I'd rather have the elephant art on my wall than the Mona Lisa. It matches the rug in the living room.
RussellA September 30, 2021 at 19:11 ¶ #602278
Quoting Constance
The artwork is a mirror of the spirit


If this were part of the Stanford University undergraduate progam in philosophy, it would be costing me $58,000 a year - so I can't complain at $40 a year.

There is no correct definition of art

The definition "art is a bottle of Guinness" is as correct as any other. Definitions are determined by Institutions and the majority of interested people.

Various definitions of art

@Constance - "Art has this, I say. It is called the aesthetic"
@Constance - "The question of art lies with one question: is there anything that is both the essence of art, what makes art, art, and absolute?"

My personal definition of visual art is aesthetic form of pictographic representation

Definitions of the aesthetic

@Constance - "As to Beauty, I don't think, frankly, Hutcheson has a clue"

I would define the aesthetic as unity in variety, along the lines of Hucheson. Hucheson is giving an objective definition of the aesthetic, not attempting to describe the subjective experience.

I can describe objective facts about the colour red - seen in strawberries, sunsets, etc, has a wavelength of 625 to 700nm. I can also describe objective facts about the aesthetic - unity in variety, observed in a painting by Matisse, a book by Cormac Mccarthy, a song by Sade, etc. But I can never describe the subjective experience of the colour red or the aesthetic to someone who can never experience the colour red or aesthetic. However, I can use language to communicate my subjective experience of the colour red or aesthetic to another person who has also experienced the colour red or aesthetic.

IE, language can communicate general things about subjective experiences but can never communicate the particular subjective experience.

Aesthetics has value of two kinds

@Constance - " in aesthetics and ethics, there is value. Value is non cognitive"

The aesthetic can have two kinds of value, and these two meanings of value are independent of each other.

1) Value as the regard that something is held to deserve, the judgement of good or bad, in that the aesthetic of a Rembrandt is better than the aesthetic of a child's crayon sketch.
2) Value as a numerical measure, magnitude, quantity. Note that aesthetic value is not binary. It is not the case that an object either has an aesthetic or doesn't. As every object has a temperature , objects may have different temperatures. As every object has an aesthetic, different objects may have a different degree of aesthetic value.

Judgement of value as regards good or bad
The good of the aesthetic may exist in either the observer or the world.

@Constance "Wittgenstein thought that Good was divinity, and I think this problematically right"
My belief is that the source of the Good is human pragmatism

1) As regards the observer, the judgement of the Good certainly exists in the observer
2) As regards the world, the question as to whether morality exists in the world independent of any observer is open to debate. Moral realism says that morality does actually exist, and it exists in a knowable, universal way. Moral subjectivism claims that morality is not real or universal, and it does not exist outside the mind.

Judgement of value as regards degree
The degree of aesthetic may exist in either the observer or the world

1) As regards the observer, the judgment of degree certainly exists in the observer.
2) As regards the world, if the aesthetic is unity in variety, meaning a particular relationship of parts to the whole, the question as to whether relations ontologically exist in the world or merely attributions made by conscious entities and expressed in language is open to debate.

Evolution explains why we have the aesthetic

@Constance - "Evolution has always been uninformative, anyway, for it could never explain meaning, aesthetic, ethical"
@Constance "Evolution, at this level, says nothing"

In the world is chaos. Sentient life is able to survive and evolve by its innate and intellectual ability to discover patterns within this seeming chaos, ie, by discovering unity in variety. In other words, humans have an aesthetic sensibility. Evolution does not explain what the aesthetic is, but evolution does explain why the aesthetic originated in sentient life.

The brain has evolved in the world to be able to survive within the world.

Human a priori knowledge is that knowledge necessary to survive in the particular world we find ourselves in. It would follow that a sentient life evolving in a different world, whether hotter, silicon based or higher gravity, would have different a priori knowledge suitable for that different world. Rorty and the neo-pragmatists accept a mind-independent reality, whilst maintaining that this world can never be knowable. The human develops beliefs and habits which allow them to adapt to their environment with success. If humans had no a priori knowledge we would be back at Hume's problem of inference regarding the observation of a constant conjunction of events. This is the problem Kant attempted to solve with his concept of the synthetic a priori.

IE, the truth is a matter of perspective. Rather than as the neo-pragmatists propose, humans can only make sense of the world by applying reason to what they observer through their senses, it is more the case that sentient life, not separate to the world but as a part of it, have evolved innate a priori knowledge of the world. Such a priori knowledge allows them an understanding of the world even before experiencing it through their senses.

Our conscious mind has transcendent connection with the world bypassing the senses

@Constance - "Art may be an open concept, utterly, but it is grounded in the pragmatic authority of our times"
@Constance - "for to speak of a world of which we are a part is to speak of something not witnessable"
@Constance - "Rorty and others deny that knowledge can in any way align with "reality" at the foundational level"
@Constance - "The real issue lies in meta-aesthetics/ethics: what is the Good?.............The understanding is pragmatic, I claim, which is why the aesthetic cannot be spoken"

Sentient life, including humans, are born with certain innate knowledge - such as the colour red, bitter tastes, acrid smells, what is hot to the touch, the pain of a headache, as well as the aesthetic. In line with Kant's view, a priori intuitions and concepts provide a priori knowledge, which also provides the framework for a posteriori knowledge. This a priori knowledge does not need to be taught, in that the brain is not a blank slate when born. IE, children don't need to go to school to learn how to have the subjective experience of the colour red.

But this is particular knowledge, in that I am not able to imagine an bitter taste independent of experiencing through my senses an object in the world that gives me the subjective experience of a bitter taste. This a priori knowledge is about the possibility of being able to experience a particular subjective experience, not the subjective experience itself. The point is that this a priori knowledge of the possibility of experiencing a particular subjective experience exists in the brain prior to any observation of the world through the senses.

IE we have a priori knowledge of certain subjective experiences prior to ever experiencing them through our senses, in that we can speak of a world which we have not witnessed.

Summary
Art is important because it is aesthetic form of representative content. The aesthetic is important because it is an innate foundational ability of sentient life to discover patterns in a seemingly chaotic world. Art is therefore an outward expression of the innate character of the brain and conscious mind.
T_Clark September 30, 2021 at 20:33 ¶ #602292
Quoting RussellA
There is no correct definition of art


Perhaps, but there are incorrect definitions of "art." There are also definitions that are of very little use. Several of those have been expounded in this thread. Art is not magical. It's a means of human expression and communication. We don't need no highfalutin definitions.

Quoting RussellA
I would define the aesthetic as unity in variety, along the lines of Hucheson. Hucheson is giving an objective definition of the aesthetic, not attempting to describe the subjective experience.


Keeping in mind that "aesthetic" actually has an accepted meaning - Concerned with beauty or the appreciation of beauty.

Quoting RussellA
But I can never describe the subjective experience of the colour red or the aesthetic to someone who can never experience the colour red or aesthetic.


I've always hated this idea - that we can't explain sight to a blind person, color to someone color blind. Of course we can. And by explain, I mean to give an intuitive understanding of what the experience is like. I'm sure it won't be as good as a sighted person's grasp would be.

Quoting RussellA
Value as the regard that something is held to deserve, the judgement of good or bad, in that the aesthetic of a Rembrandt is better than the aesthetic of a child's crayon sketch.


Ok, as long as you aren't selling that more sophisticated means better. I have a drawing my younger son (five when he painted it, 31 now) that I love as much as anything I've seen. Not just because it's from him. It's a night time view of a simple dark blue sky over a black ground surface with a bright yellow flash of lightening cracking across the sky. It was shockingly beautiful when I first saw it 26 years ago and it still makes me smile. It was up on his door until he left home a few years ago. There's a saying in country music - three chords and the truth. There is a connection between technique and beauty, but it is not a simple one.

Quoting RussellA
Evolution does not explain what the aesthetic is, but evolution does explain why the aesthetic originated in sentient life.


Well, maybe. Sure our brain evolved to establish patterns, but it also evolved to assign value. As far as beauty is concerned, value may be as much or more important than pattern.

Quoting RussellA
Human a priori knowledge is that knowledge necessary to survive in the particular world we find ourselves in. It would follow that a sentient life evolving in a different world, whether hotter, silicon based or higher gravity, would have different a priori knowledge suitable for that different world.


It is my understanding that humans are not born with much a priori knowledge of the world. We are born with inborn instincts for certain ways of processing the world, learning about it, e.g. language.

Quoting RussellA
Sentient life, including humans, are born with certain innate knowledge - such as the colour red, bitter tastes, acrid smells, what is hot to the touch, the pain of a headache, as well as the aesthetic.


I don't think we are born with a priori knowledge or color, acidity, bitterness, pain, or heat. We are born with the equipment to collect sensory input and the processing ability to interpret and use it. We have sensors in our mouths that are sensitive to acid, bitterness, saltiness, and sweet. We have sensors in our eyes that are sensitive to light and three colors (if my memory is correct).

Quoting RussellA
But this is particular knowledge, in that I am not able to imagine an bitter taste independent of experiencing through my senses an object in the world that gives me the subjective experience of a bitter taste.


I'm sure someone could induce a bitter taste in your mouth with direct stimulation of specific taste buds with no contact with a substance we would call "bitter."

Quoting RussellA
The aesthetic is important because it is an innate foundational ability of sentient life to discover patterns in a seemingly chaotic world.


I don't know if this is true or not.

I was going to say that I think you are over-simplifying things, but I think what you are really doing is over -complicating them.
Constance October 01, 2021 at 02:44 ¶ #602360
Quoting Pop
When information informs you, it changes your neural state such that you ultimately have an experience.


But the art object did not carry or transfer or simply "inform" about something else. Rather, when the art object is absent, and one is left with the "information" we actually find the presence of the object. What is it that is there in consciousness, the authentic locus of art, that is not the object, but rather, what the object delivered, told about, informed about? When I think of Dvorak's Slavonic Dances, it is the same music I hear in the "object" of the performance. What does a Dickens tale tell that is not the tale itself?

Suggested here is the myth of the art object: There is no object that properties inhere in. All along, the consciousness itself is what inheres in the art work. for boundaries fall apart in analysis. The art work and its affect and ideas are one "object". Thus, (and this is very much Dewey) there is no separation in anything, but rather, all separations (like Kant's reason) are analytically abstracted. Information, in cognitive, truth bearing vehicles like paintings and novels, cannot be distanced at all from consciousness, for they are an intrinsic part of it.

Is information inherently aesthetic for you? There never really was any consciousness-neutral object that informed simply, for to even mention the object, to conceive it is to "make" a conscious construction. Perhaps you think the object is a transcendental medium, appearing to consciousness AS information (for this is what we do at the moment of apprehension), but in itself without any identifiable features. After all, once such features are posited, we are then IN consciousness. If the art object is a transcendental medium, then there is overcome the objection that the object and conscious apprehension of the object are the same thing, for the object now has no features at all. There is no symphonic performance out there and in here (my consciousness) the artistic event, for the performance itself is a conscious event. I actually come close to endorsing this.

But you do insist on that one big point of contention: Information???? Here I am enjoying this novel or aesthetically enraptured (Clive Bell) by a Van Gogh: Is it the case that I have been "informed" by the actual object. whatever it is? Informed by a newspaper, yes, but....One is not informed when have an aesthetic experience. This is cognitive, this being informed.

The art object is not information bearing, it is evocative, arousing, empassioning, and so forth.



TheMadFool October 01, 2021 at 03:29 ¶ #602363
Quoting T Clark
Both these paintings are done by elephants:


:rofl: A nose job!
RussellA October 01, 2021 at 11:40 ¶ #602452
Quoting T Clark
"art."


@T Clark - "There are also definitions that are of very little use" (y)

@T Clark - "Keeping in mind that "aesthetic" actually has an accepted meaning - Concerned with beauty or the appreciation of beauty"

Not exactly.

Aesthetic as an adjective is the study of beauty.

But beauty as a noun surely has a different meaning to aesthetic as a noun. For example, taking the examples of Picasso's Guernica 1937, a moving and powerful anti-war painting, and Bouguereau's 1873 Nymphs and Satyr, mythological themes emphasising the female human body

Dictionary definitions generally agree that aesthetic as a noun means a set of principles governing the idea of beauty, such as "modernist aesthetics" and beauty as a noun means qualities such as shape, colour, sound in a person or thing that gives pleasure to the senses.

Both the Picasso and Bouguereau are important paintings and have aesthetic values. Whilst the Bouguereau may be said to give pleasure to the senses, the Picasso certainly doesn't.

IE, it follows that the aesthetic must be more than being concerned with beauty

@T Clark - "I've always hated this idea - that we can't explain sight to a blind person"

I know the subjective experience of colours in the visible light spectrum, red, orange, yellow, green, cyan, blue, violet. It seems that reindeer can also see the colour ultraviolet, which is useful to them in spotting lichens that they can eat.

The trick is, can you explain to me in words the subjective experience of the colour ultraviolet !

@T Clark - three cords and the truth. (y)

Exactly. Matisse's Cut-outs are some of my favourite artworks, minimal yet sophisticated.

@T Clark - value may be as much or more important than pattern. (y)

@T Clark - We are born with inborn instincts for certain ways of processing the world, learning about it...................We are born with the equipment to collect sensory input and the processing ability to interpret and use it" (y)

I agree.

I wrote "Humans have a priori knowledge", and I agree that my use of the word "knowledge" may be problematic, but I stick with it

"Knowledge" is defined as "facts, information, and skills acquired through experience or education; the theoretical or practical understanding of a subject" which seems fair enough.

1) Our inborn instincts could be said to include "facts, information and skills"
2) Our "experience and education" has been acquired through billions of years of evolution rather than the schoolroom.
3) As regards innate "theoretical or practical understanding" of the colour red say, "understanding" may be defined as the capacity to apprehend general relations of particulars and the power to make experience intelligible by applying concepts. Then it must be the case that the brain has the innate capacity to apprehend general relations of particulars and does have the innate power to make experience intelligible.

IE, I stick with the concept of "a priori knowledge"
Constance October 01, 2021 at 13:10 ¶ #602481
Quoting Pop
The viewer experiences the art work in a Enactivist fashion, where the consciousness of the viewer and the form of the art work, interact to cause an experience. The experience is not entirely the result of the artwork, nor entirely the result of the viewer, but is an amalgam of the two - experienced by the viewer. In the best of cases, these two gel to cause a pleasant experience, rather than repel, which would be an unpleasant experience, or one that is bypassed altogether.


Enactivism? If a person wants to examine at the basic level the interface between things and their subjective counterparts, one will NEVER be able to distinguish the two. You can argue against this if you like, but analytic philosophers gave up on this impossible idea long ago. They now simply put the whole epistemic embarrassment aside and imagine Kant through Heidegger never existed.
If you are interested in, as Hegel put it, the truth, then basic level assumptions have to be dealt with, and this leads only to one place: phenomenology.
So the information bearing object has no status at all until it is received. I would call this a qualified information bearing transcendental object (hermeneutically defined AS art upon arrival. This "AS" of course, puts art back in the hands of the aesthetic and its nature. This is inherently affective); but information has to be redefined in a way that defies its essential meaning.
T_Clark October 01, 2021 at 17:23 ¶ #602559
Quoting RussellA
Dictionary definitions generally agree that aesthetic as a noun means a set of principles governing the idea of beauty, such as "modernist aesthetics" and beauty as a noun means qualities such as shape, colour, sound in a person or thing that gives pleasure to the senses.


That definition is not inconsistent with my meaning. The definition said "beauty," not "prettiness" or "pleasurableness."

Quoting RussellA
The trick is, can you explain to me in words the subjective experience of the colour ultraviolet !


I think I could, but not just in words. It would have to be related to how the person uses their other senses. I can imagine what a bat's echolocation might be like. If I could talk to one, I could probably get a better feel for it. Never as good as a bat, but something at least. As for color, I could never transmit the actual experience, but I could explain how it works when I see something. What things and types of things have which colors. Shadows. I don't know whether a blind person would be interested in those things.

Quoting RussellA
Matisse's Cut-outs are some of my favourite artworks, minimal yet sophisticated.


Three chords and the truth is a vote for the value of unsophisticated art. The truth, in this sense, is not a matter of sophistication. It's what comes from the heart.

Quoting RussellA
Our inborn instincts could be said to include "facts, information and skills"


You're stretching the meaning of those words to match reality.

Quoting RussellA
Our "experience and education" has been acquired through billions of years of evolution rather than the schoolroom.


Again, you are distorting the meaning of "experience and education."

Quoting RussellA
Then it must be the case that the brain has the innate capacity to apprehend general relations of particulars and does have the innate power to make experience intelligible.


Two points. First, I think you're distorting language again. Second, it is my understanding that a lot of the sensory "knowledge" you are talking about comes from the actual machinery, e.g. taste buds for specific chemicals and rods and cones for specific ranges of light and color. Calling that "knowledge" is more than just a distortion.
Pop October 02, 2021 at 07:17 ¶ #602786
Quoting TheMadFool
2. Is something wrong with your definition Pop?


We have already been through this. Whilst an Ai can be programmed , and an elephant taught to create a repetitive picture, they neither choose to do so, nor do they deem it to be art in the human tradition. An artist chooses to make something and deems it to be art – in the tradition of art. You may find Chimpanzees might choose to make paintings if left with paint and they have been shown how to, but they do not, cannot deem what they make to be art. The definition is watertight and I am tired of repeating why.

You can not invalidate the definition for obvious self evident reasons. Instead why not choose two different art works and compare them, and ask yourself why are they different? What are the elements that make them different? Ask yourself will an Australian aboriginal make the same art as an 18th century Russian peasant, and then answer why. Perhaps then we can take this conversation out of mid high school, to perhaps upper high school level, and maybe beyond.

In any case I am otherwise occupied with three Kidney stones, in the midst of school holidays , and lockdown, and no relief in sight, so wont be around much.
Pop October 02, 2021 at 07:37 ¶ #602797
Quoting Constance
Enactivism? If a person wants to examine at the basic level the interface between things and their subjective counterparts, one will NEVER be able to distinguish the two.


:100:

Quoting Constance
So the information bearing object has no status at all until it is received. I would call this a qualified information bearing transcendental object (hermeneutically defined AS art upon arrival. This "AS" of course, puts art back in the hands of the aesthetic and its nature. This is inherently affective); but information has to be redefined in a way that defies its essential meaning.


:up: Yes information needs to be redefined, or perhaps better put - it's original meaning needs to be reinstated - which is to inForm - literally change the shape of, including changing the shape of mind.

Information and consciousness are related and enormous topics in information philosophy which is the way of the future, imo. I think we are near enough in our understanding. I will do more information threads in the future, so perhaps we can discuss in more detail later. This relates to your previous post.
TheMadFool October 02, 2021 at 10:45 ¶ #602837
Quoting Pop
We have already been through this. Whilst an Ai can be programmed , and an elephant taught to create a repetitive picture, they neither choose to do so, nor do they deem it to be art in the human tradition


Your definition does not include the elements of choice and belief that something is art and if it did, then we're in territories that seem alien to art (choice) and arbitrary (if I deem this :point: * is art then it is).

I dunno!
praxis October 02, 2021 at 18:49 ¶ #602944
I stumbled onto Dr Rupert Sheldrake, something of a pop * C O N S C I O U S N E S S * guru, and he seems to think that mystical experiences validate the belief in universal consciousness. Remove the self and the self becomes everything, the reasoning seems to be. Rather anthropomorphic if you asked me.
Pop October 02, 2021 at 22:52 ¶ #603008
Quoting TheMadFool
Your definition does not include the elements of choice and belief that something is art and if it did, then we're in territories that seem alien to art (choice) and arbitrary (if I deem this :point: * is art then it is).


Quoting Pop
Proof of the definition:

?1.    Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.


Quoting praxis
something of a pop * C O N S C I O U S N E S S * guru


Consciousness has nothing to do with religion or Gurus. In phenomenology and neuroscience consciousness can be broken down into moments of consciousness lasting 1-400ms according to these studies. From this point of view life is a procession of moments of consciousness - nothing exists outside of moments of consciousness, and everything that you do , you do in response to these moments, including make art.
praxis October 02, 2021 at 22:59 ¶ #603013
Quoting Pop
nothing exists outside of moments of consciousness


How exactly do you know that?
Pop October 02, 2021 at 23:38 ¶ #603026
Quoting praxis
How exactly do you know that?


Read the linked studies. Brush up on phenomenology. Produce something that exists for you outside of consciousness of it. I think you will find it is impossible.
Pop October 03, 2021 at 03:31 ¶ #603078
Quoting RussellA
Summary
Art is important because it is aesthetic form of representative content. The aesthetic is important because it is an innate foundational ability of sentient life to discover patterns in a seemingly chaotic world. Art is therefore an outward expression of the innate character of the brain and conscious mind


:100:

** I think this video, where Van Gogh visits a gallery in the future, and how his work is interpreted by the gallerist is a really good illustration of this.

praxis October 03, 2021 at 03:59 ¶ #603082
Quoting Pop
Produce something that exists for you outside of consciousness of it.


I don’t know what exists beyond of my consciousness. I’m not even sure about what ‘exists’ within my consciousness. If you want to be a player in the consciousness guru game you will need to learn how to embrace the unknown, or at least learn how to pretend that you can.
Pop October 03, 2021 at 04:07 ¶ #603083
Quoting praxis
If you want to be a player in the consciousness guru game


I don't want to be a player in the consciousness guru game. I want to be a player in the art definition game. :lol: I also would like to understand myself, and the world that I live in, and consciousness and information are absolutely pertinent considerations to that end, imo.
praxis October 03, 2021 at 04:18 ¶ #603087
Quoting Pop
I don't want to be a player in the consciousness guru game. I want to be a player in the art definition game. :lol:


What these games have in common is the desire to influence rather than the desire experience the aesthetic. This disparity is worlds apart.
Pop October 03, 2021 at 04:22 ¶ #603088
Quoting praxis
What these games have in common is the desire to influence rather than the desire experience the aesthetic. This disparity is worlds apart.


Who is trying to influence now?
TheMadFool October 03, 2021 at 05:41 ¶ #603099
Quoting Pop
Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information.


Inconcistency detected. Art, by the first sentence, is arbitrary. Then the second sentence mentions there's got to be something "...extra..." (art information).
Pop October 03, 2021 at 06:23 ¶ #603109
Quoting TheMadFool
Inconcistency detected. Art, by the first sentence, is arbitrary. Then the second sentence mentions there's got to be something "...extra..." (art information).


This is what distinguishes art from ordinary objects - art has this extra deemed art information. ( Duchamp's urinal ) ( readymade art ).
No there is no inconsistency - an artist can bite his patron on the leg, and deem it to be art. An artist can do anything and deem it to be art.

I'm not answering any more questions of this nature. If you wish to focus on how art reflects the consciousness of an artist, through an examination of various art works, then I would be happy to oblige, but this type of questioning, now 17 pages long, has been done to death, imo.
TheMadFool October 03, 2021 at 07:31 ¶ #603121
Quoting Pop
No there is no inconsistency - an artist can bite his patron on the leg, and deem it to be art. An artist can do anything and deem it to be art.


In other words, anything and everything is art. Why define it then, definitions being restrictive criteria?
RussellA October 03, 2021 at 08:47 ¶ #603132
Quoting Pop
Van Gogh


(y) If only in real life were there Doctor Henry Black's who were present in art museums explaining to the passing public the importance of the paintings they were looking at.
RussellA October 03, 2021 at 08:54 ¶ #603133
Quoting T Clark
(a priori knowledge)............"You're stretching the meaning of those words to match reality.


In a sense I am stretching the meaning of the words a priori and knowledge within the phrase "a priori knowledge".

But in the case of the phrase "a priori knowledge", it is the phrase as a whole that has meaning rather than the particular words within it. It is the same as if I said "In my job interview I had to jump through hoops", where the concept "jump through hoops" is not determined by the particular words jump, through and hoop. Or if a said "Mary is a breath of fresh air" or "John flew off the handle". In the same way, expressions such as "a priori knowledge", "synthetic a priori" and "transcendental idealism" are more idiomatic expressions than literal descriptions. The phrase "a priori knowledge" then becomes a key phrase when used in search engines conveniently leading to more extensive explanations, such as in The Internet Encyclopedia of Philosophy, Stanford Encyclopedia of Philosophy or Wikipedia.

IE, "a priori knowledge" is an idiomatic expression and is only a guide to the concept rather than a literal description of it.
praxis October 03, 2021 at 15:12 ¶ #603222
Quoting Pop
Who is trying to influence now?


Influence is my art form. :nerd:

But seriously, earlier you wrote:
A definition of art, and I’m not saying my definition is necessarily it, has the potential to shift the power balance in the art world, back into the hands of the intellectuals and the artists. This is my primary goal.


It’s not clear how this will change anything. Could you enlighten us? Also, those with power and influence will have power and influence regardless of how art is defined. They’ll still be able to influence culture and speculate on the value of art.
T_Clark October 03, 2021 at 17:56 ¶ #603253
Quoting RussellA
IE, "a priori knowledge" is an idiomatic expression and is only a guide to the concept rather than a literal description of it.


This post is not relevant to the discussion we are having on this thread. What's up with that?
Constance October 03, 2021 at 18:03 ¶ #603258
Quoting RussellA
There is no correct definition of art


The reason art cannot be given a definition is that art is affect-entangled, and entanglements are arbitrary, meaning there is nothing in affect that constrains what art can be since there is no thing that cannot be so entangled. Art is IN the fabric of experience, taken up by those with a purpose to do so. Dewey was right, but problem solving's consummatory feature seems an unlikely explanation. Affect is, as Wittgenstein said (reluctantly), mysterious, but it is THE essential feature of art.

Quoting RussellA
The definition "art is a bottle of Guinness" is as correct as any other. Definitions are determined by Institutions and the majority of interested people.


Begs the question: But then, I ask, what is it about a bottle of Guinness makes it art?

Quoting RussellA
Various definitions of art

@Constance - "Art has this, I say. It is called the aesthetic"
@Constance - "The question of art lies with one question: is there anything that is both the essence of art, what makes art, art, and absolute?"

My personal definition of visual art is aesthetic form of pictographic representation



And, you mean that which elicits aesthetic rapture? Bell's book ART says this. There is something plausible about this, but then, visual form may elicit the aesthetic, but form as such is not some emerging quality of form, for form itself is not aesthetic. One has to go elsewhere for this.
But it is the formal properties that make or break the affect. Music as well. Literature, narratives, poetry are far too entangled for this, though. These are not "fine" arts, are they. But then poetry is closer, concentrated, if you will. Dewey was right on that account.

Across the board, it is affect that endures as the essence of art. Entanglement makes theory indeterminate, as with ethics; nonetheless, no affect/aesthetic, no art.

Quoting RussellA
I can describe objective facts about the colour red - seen in strawberries, sunsets, etc, has a wavelength of 625 to 700nm. I can also describe objective facts about the aesthetic - unity in variety, observed in a painting by Matisse, a book by Cormac Mccarthy, a song by Sade, etc. But I can never describe the subjective experience of the colour red or the aesthetic to someone who can never experience the colour red or aesthetic. However, I can use language to communicate my subjective experience of the colour red or aesthetic to another person who has also experienced the colour red or aesthetic.

IE, language can communicate general things about subjective experiences but can never communicate the particular subjective experience.


Something like that, or not. Too many issues in this. My take is that there is no world, only worlds. Not to say there isn't anything outside of a given world, just that whatever that is, it is not a world. But the interiority of a world, now that is where all meaning is, that Cartesian center: not just a cogito, but an affective-cogito discoverable, it is argued, through apophatic argument.

Quoting RussellA
But this is particular knowledge, in that I am not able to imagine an bitter taste independent of experiencing through my senses an object in the world that gives me the subjective experience of a bitter taste. This a priori knowledge is about the possibility of being able to experience a particular subjective experience, not the subjective experience itself. The point is that this a priori knowledge of the possibility of experiencing a particular subjective experience exists in the brain prior to any observation of the world through the senses.


Take a look here: Ours senses deliver experiences to us. Predication is not apriori, but empirically discursive, as when we say the the sky is blue, this has to be affirmed with a reference to the empirical event in which the sky appears, and is blue. Apriority is a reference to what is discovered In this experience but is not delivered through predication, but is true by virtue of the experience's givenness. Reason, thought Kant, is apriori because, while it is discovered in judgment and thought, the empirical conditions of its affirmation do not deliver this. It is rather in the form of a judgment. When you talk about the apriority of color, taste and so on, you are then saying that there is something in the delivery of color, say, AS color that is not discursive, but simply given.

Calling an eclair sweet is certainly not apriori, for one has to taste the eclair, recognize the sweetness, associate the eclair with the sweetness, then make the judgment. You are saying the taste in its givennes is not determined by experience. Givenness is not determined empirically because it is not a determination based on experience, it IS experience. It is not about the brain at all. It is a phenomenological matter, looking exclusively to the givenness, and not to extraneous discursions.
One trouble thinking like this comes from Derrida and postmodern thinking on direct apprehensions in the "immediacy" of the given. But I am not interested in that here. I follow Husserl and his epoche as it is developed in post post modern thinking (Jean luc Marion and others). And it is here I will leave off making any references to who said what, for my thinking is in a simple (certainly related, though) argument:

I think art is to grounded in the aesthetic, and the aesthetic is to be grounded in affect. Beyond this, something may HAVE an "art" to it, as in the art of winning friends or basket weaving, or the culinary "arts" but to the extent a thing is appreciated for its utility or its cognitive "properties" (definitions, predications of other things or within its own parts, say), or it "informational" properties (the OP here) it is not art. The "art of such and such" certainly does possess affect, but then, everything possesses affect, which is why "everything is art" seems to hold up. Art requires taking a thing AS art, and this AS looks to its affective dimension.

This brings the issue to Wittgenstein, and why he refused to talk about ethics and aesthetics. The Good and the Bad here are not contingent, but absolute, and he would talk about such things because they are simply givens, and discussion cannot be useful. In fact, conversation is nonsense on matters like this. He goes too far, I think, in denying that sense can be made here (in the Tractatus. Language games? Not so sure).

The reason I say a definition of art is qualifiedly possible is because art's aesthetic is given, and givens, I claim, are absolutes. I can argue this pretty well I believe, but that would be up to you and your interests.
Constance October 03, 2021 at 18:27 ¶ #603265
Quoting Pop
Yes information needs to be redefined, or perhaps better put - it's original meaning needs to be reinstated - which is to inForm - literally change the shape of, including changing the shape of mind.

Information and consciousness are related and enormous topics in information philosophy which is the way of the future, imo. I think we are near enough in our understanding. I will do more information threads in the future, so perhaps we can discuss in more detail later. This relates to your previous post.


Not my post. No matter. So you're saying the art object (not art) is reducible to a transcendental information bearing medium. This turns the object into pure potential. And information? IF information is defined as being free of information, as this definition tells us it is, for the object is divested of all observable qualities (hence, transcendental) and all that remains is dispositional "qualities" whatever that could be, then this is also true of newspapers, and everything else.....; then this would be a real stretch from the way we think of information, and you would have to be an idealist of sorts.

Well, I am an idealist of sorts. So my only gripe is that you have defined information by the limits of its meaning.
baker October 03, 2021 at 22:37 ¶ #603357
Quoting T Clark
I see many art works as actually dealing with philosophical problems, but the artists themselves and their audience often don't see it that way.
— baker

If the artists and audience don't see it, maybe it comes from you. That's not a criticism. The experience of art includes how it fits in with the rest of our experience.


One can also think of cooking as a matter of physics and chemistry.
Explicit knowledge of physics and chemistry are not needed in order to cook.

The metalevel knowledge is not always necessary, but it is possible.
Pop October 04, 2021 at 07:13 ¶ #603537
Quoting Constance
then this would be a real stretch from the way we think of information, and you would have to be an idealist of sorts.

Well, I am an idealist of sorts. So my only gripe is that you have defined information by the limits of its meaning.


I was an idealist, but am now an enactivist. It is a slightly better understanding, imo.

Yes, it is a different understanding of information, compared to what generally prevails. It fits the following theories: Integrated Information Theory tells us that consciousness exists as moments of integrated information. Systems Theory tells us that interaction is information, and nothing exists outside of interaction. Enactivism tells us that we are enacted / interacted in the world informationally, and Constructivism tells us that it is a body of integrated information that becomes knowledge, in an evolving and idiosyncratic fashion and what we are is a product of this.
Pop October 04, 2021 at 07:40 ¶ #603546
Quoting praxis
It’s not clear how this will change anything. Could you enlighten us? Also, those with power and influence will have power and influence regardless of how art is defined. They’ll still be able to influence culture and speculate on the value of art.


I did say it was a long shot - Indeed! Flat earthers can believe that the Earth is flat despite all the evidence against it, but not with credibility in the eyes of most people. One can ignore this definition, but not with credibility, imo. It is a thorn in the side of those who think art is for art's sake, as it proves art is an expression of consciousness - regardless of the art's form.
RussellA October 04, 2021 at 10:08 ¶ #603599
Quoting T Clark
(a priori knowledge).. .....This post is not relevant to the discussion


Since at least the Lascaux cave paintings 17,000 years ago, beauty and aesthetics have been considered part of the essence of the meaning of art, part of the "definition of art".

Sentient life is born with certain innate "a priori" abilities. We are able to know the subjective experience of the colour red, a bitter taste, an acrid smell, the pain of a headache, as well as aesthetic form. These subjective experiences don't need to be taught in school.

In Western philosophy since the time of Immanuel Kant, such knowledge, acquired independently of any particular experience, has been known as "a priori knowledge".

IE, any discussion of art needs an understanding of aesthetics, which in its turn needs an understanding of "a priori knowledge".
Tom Storm October 04, 2021 at 10:18 ¶ #603603
Quoting RussellA
E, any discussion of art needs an understanding of aesthetics, which in its turn needs an understanding of "a priori knowledge".


Can you identify a critic or writer who embodies this view?
RussellA October 04, 2021 at 13:17 ¶ #603657
Quoting Tom Storm
Can you identify a critic or writer who embodies this view


In particular - Professor Denis Dutton.

In general - "Evolutionary Aesthetics".

Professor Dutton talks about "The Art Instinct" at www.youtube.com/watch?v=R-Di86RqDL4
PseudoB October 04, 2021 at 13:36 ¶ #603663
Art devoid of Truth is merely imagination without will.
frank October 04, 2021 at 13:42 ¶ #603666
Reply to PseudoB

Beauty is truth
truth beauty
that is all ye know on earth
and all ye need to know
Constance October 04, 2021 at 14:44 ¶ #603694
Quoting Pop
I was an idealist, but am now an enactivist. It is a slightly better understanding, imo.

Yes, it is a different understanding of information, compared to what generally prevails. It fits the following theories: Integrated Information Theory tells us that consciousness exists as moments of integrated information. Systems Theory tells us that interaction is information, and nothing exists outside of interaction. Enactivism tells us that we are enacted / interacted in the world informationally, and Constructivism tells us that it is a body of integrated information that becomes knowledge, in an evolving and idiosyncratic fashion and what we are is a product of this.


But the reductive direction of this for a human being is appalling. Surely you see that, even while you want to allow consciousness its breadth and depth of experience, by generalizing to information, you lean toward this term to do your explaining. Keep in mind the way behaviorists dealt with human meanings in their reductive tendencies.
Idealism? Better, phenomenology: this term makes MEANING front and center, a meaning is broad enough a term to be inclusive if information (say, dictionary or encyclopedic knowledge) as well as affective experiences.
Of course, to give this the benefit of the doubt, consider that an art object is a system of signs, and we are the interpreters. Just as I see a cup AS a cup, I see an artwork AS an artwork. This would be as close as I can imagine the idea of information being plausible. But then, the aesthetic of art, which I claim is essential, indeed, the most essential, defining, dimension of art, is subordinated to information, hence, the trouble with the direction of this reduction, and it is the same as calling food information or a sprained ankle information: such a reductive tendency leads to a foolish loss of MEANING. Meaning must be front and center, and information is just a dimension of meaning.
Constance October 04, 2021 at 14:46 ¶ #603696
Quoting PseudoB
Art devoid of Truth is merely imagination without will.


What can this mean????????? Not that it is wrong, but it requires some explanation as to truth, will. I mean, where does will enter into it?
PseudoB October 04, 2021 at 14:55 ¶ #603702
As I see it, there is Truth and there is Perspective. Which understanding presents one with a Choice in which to allow to cause action or word.... No action or word occurs without will. One does not get up from the couch without willing something in the fridge, for example. Some will run wild with this without understanding, and thus produce nothing to affect change, thus solidifying the lies they believe and using such momentum's to force upon unsuspecting minds.
praxis October 04, 2021 at 15:43 ¶ #603721
Quoting Pop
It is a thorn in the side of those who think art is for art's sake, as it proves art is an expression of consciousness - regardless of the art's form.


Claiming that art is an expression of consciousness in no way contradicts aestheticism. It’s as though you’re saying that defining art as an expression of consciousness somehow proves that art is inherently didactic. That makes no sense whatsoever.

It seems to me that you’re problem isn’t with aestheticism but simply a general lack of art appreciation in society, assuming the concern were honest. Defining art as an expression of consciousness doesn’t help, and I don’t think it’s designed to help. It’s designed to exploit the lack of art appreciation in order to influence.
T_Clark October 04, 2021 at 16:46 ¶ #603749
Quoting RussellA
Since at least the Lascaux cave paintings 17,000 years ago, beauty and aesthetics have been considered part of the essence of the meaning of art, part of the "definition of art".


I'm guessing that Oog Eep in the cave wasn't thinking much about aesthetics. Maybe she was. Being so sure about what she was thinking is a presumptuous.

Quoting RussellA
Sentient life is born with certain innate "a priori" abilities.


"A priori" is defined as "Relating to or denoting reasoning or knowledge which proceeds from theoretical deduction rather than from observation or experience." You wrote me an irrelevant post about my misuse of the phrase and now you're trying to change the meaning.

Quoting RussellA
We are able to know the subjective experience of the colour red, a bitter taste, an acrid smell, the pain of a headache, as well as aesthetic form. These subjective experiences don't need to be taught in school.


You made your original argument about a priori knowledge. I responded with very concrete reasons why I thought your argument was not accurate. Now you've just repeated the same argument without responding to my comments.

Quoting RussellA
In Western philosophy since the time of Immanuel Kant, such knowledge, acquired independently of any particular experience, has been known as "a priori knowledge".


In the 200 or so years since Kant died, people have done a lot of work studying human cognition, perception, and child development. Kant was not a cognitive scientist.

Tom Storm October 04, 2021 at 20:27 ¶ #603861
Quoting PseudoB
Art devoid of Truth is merely imagination without will.


Interesting. I have never associated truth with art. I'm not even sure how they would relate.
Tom Storm October 04, 2021 at 20:33 ¶ #603864
Quoting RussellA
In particular - Professor Denis Dutton.


Thanks. I remember Dutton's work establishing Arts Letters Daily and I enjoyed his criticism of pretentious and meaningless academic language which is sometimes evident on this site - especially in discussing aesthetics.
PseudoB October 04, 2021 at 21:45 ¶ #603885
Reply to Tom Storm clearly the Artists of old mixed art and truth, as Fulcanelli reveals in the Mystery of the Cathedrals.
Tom Storm October 04, 2021 at 22:03 ¶ #603894
Reply to PseudoB I think these are the kinds of statements you can only make if you hold a series of assumptions. I think Cathedrals can probably be reimagined as monuments to metanarratives now defunct.
PseudoB October 04, 2021 at 22:20 ¶ #603908
Reply to Tom Storm “defunct”?? From a lesser Perspective maybe, but clearly even modern scientists at CERN even find the mixture of art and truth an effective expression of said truth.
Tom Storm October 04, 2021 at 22:31 ¶ #603914
Quoting PseudoB
From a lesser Perspective maybe, but clearly even modern scientists at CERN even find the mixture of art and truth an effective expression of said truth.


I wasn't ware that Truth had finally been found.

Perhaps you could start by explaining what truth is when it comes to art. A few dot points will do so we can see where you're heading with this.
PseudoB October 05, 2021 at 00:20 ¶ #603945
Well, without being too open, I will try to point at it. Reason being because one must invest into the equation, to have a personal experience with the Truth, else one is just taking another’s experience as Gospel, with no personal evidence.

The scientific mind is indeed the closest to the Truth in these days, but on needs to see the relationship between where we came from and how the four Elements function. The relationship of the Elements, in practice, presents as a fire heated seven times hotter than normal.

This furnace is depicted in every Cathedral, and the hints in concrete and metal artwork throughout history. The Key allows for the greening and growing of Splendor Solis, that is also in every business building’s artwork, whether in stone or art.

Once one can see this unspoken Cabala all throughout every aspect of society, as a constant reminder of the renewing of the mind needed to accomplish the Worke.

Many have said there is more Truth in the first ten scriptures of Genesis than in all the libraries of the world. To answer the question, “what is Truth”, I can only answer: what has no opposition, and is always, regardless of Experience. Truth accounts for all experience of solidity, where all came from a Water.

I hope I have not overstepped.
Pop October 05, 2021 at 01:01 ¶ #603949
Quoting Constance
But the reductive direction of this for a human being is appalling


Ha, ha, You mean this is far different to the ingratiating and romantic philosophy of the likes of Dewey and co. Yes it is. The thing to remember is that this is just the barebones underlying logic. It still need to be interpreted in terms of daily life and aspirations, and so on. So there is plenty of room to romanticize it if that is what you wish, and any sensible philosopher wishing to be popular would be wise to do this to some extent. :grin:

Quoting Constance
But then, the aesthetic of art, which I claim is essential, indeed, the most essential, defining, dimension of art, is subordinated to information, hence, the trouble with the direction of this reduction, and it is the same as calling food information or a sprained ankle information: such a reductive tendency leads to a foolish loss of MEANING. Meaning must be front and center, and information is just a dimension of meaning.


I'm afraid you misunderstand, and I can not see a simple way to redirect you. I will be doing a few more information threads in the near future, so If you are interested perhaps take it up then.

Instead I'll say: Meaning only exists as integrated information - when information is unified and integrated it becomes meaningful, and not before.

And: In an experience you are inFormed, and you have an experience in relation to how you are informed. So information is the fundamental observable - the fundamental interaction that gives rise to experience, in all situations, including art.
Pop October 05, 2021 at 02:06 ¶ #603963
Quoting praxis
Claiming that art is an expression of consciousness in no way contradicts aestheticism.


I don't wish to say that art is not aesthetic, plainly it is. However all experience is aesthetic, so to focus on aesthetics as the defining feature that separates art from everything else is an error. Before something can be an experience, we first need information about it ( see my reply to Constance above ) So firstly art is information, and it can only be information about the artist's state of mind whilst making it. So art is information about the artist's consciousness ( hopefully you understand consciousness a little more broadly by now ). This is definitely the case for all art for all time, and there is nothing more that is definite that can be said about art - for all art, for all time. Yes art is aesthetic, but there is nothing definite that can be said about its aesthetic quality - what is beautiful to one person, can be ugly to another. You can not, and you have not put forward any arguments or propositions that define art in terms of aesthetics - don't forget we are talking about all art for all time across all cultures, no matter it's form, including unpredictable art of the future.

Quoting praxis
It seems to me that you’re problem isn’t with aestheticism but simply a general lack of art appreciation in society, assuming the concern were honest. Defining art as an expression of consciousness doesn’t help, and I don’t think it’s designed to help. It’s designed to exploit the lack of art appreciation in order to influence.


It doesn't really matter what you or I personally think. Our intentions are entirely irrelevant. What matters is that art can be defined - to this extent and no further. If this is the case, then this is the central, and most pertinent element of all art - that it is information about consciousness. This makes all art meaningful, as an expression of consciousness, regardless of anybody's personal preferences or motives, or understanding.
T_Clark October 05, 2021 at 02:10 ¶ #603965
Quoting Tom Storm
I have never associated truth with art. I'm not even sure how they would relate.


I always think of Keat's "Ode on a Grecian Urn."

Beauty is truth, truth beauty,' - that is all ye know on earth, and all ye need to know.

Sounds good, but I don't know what it means either.
T_Clark October 05, 2021 at 02:20 ¶ #603967
Quoting Pop
So art is information about the artist's consciousness ( hopefully you understand consciousness a little more broadly by now ).


This is so pompous, pretentious. Where did you learn that bolding something makes it a better argument. It makes you look like a putz.

Quoting Pop
So art is information about the artist's consciousness


I wonder how many times you've written this in this discussion. I was going to count but I'm too lazy. It's still bullshit, not matter how many times you say it. It's meaningless. My definition is scientific and falsifiable...What the fuck does that even mean. It's embarrassing.

I promised myself I would stay out of this, but the Force tells me I have to intervene. Just end it, would you please.
Constance October 05, 2021 at 02:24 ¶ #603969
Quoting Pop
But the reductive direction of this for a human being is appalling
— Constance

Ha, ha, You mean this is far different to the ingratiating and romantic philosophy of the likes of Dewey and co. Yes it is. The thing to remember is that this is just the barebones underlying logic. It still need to be interpreted in terms of daily life and aspirations, and so on. So there is plenty of room to romanticize it if that is what you wish, and any sensible philosopher wishing to be popular would be wise to do this to some extent. :grin:

But then, the aesthetic of art, which I claim is essential, indeed, the most essential, defining, dimension of art, is subordinated to information, hence, the trouble with the direction of this reduction, and it is the same as calling food information or a sprained ankle information: such a reductive tendency leads to a foolish loss of MEANING. Meaning must be front and center, and information is just a dimension of meaning.
— Constance

I'm afraid you misunderstand, and I can not see a simple way to redirect you. I will be doing a few more information threads in the near future, so If you are interested perhaps take it up then.

Instead I'll say: Meaning only exists as integrated information - when information is unified and integrated it becomes meaningful, and not before.

And: In an experience you are inFormed, and you have an experience in relation to how you are informed. So information is the fundamental observable - the fundamental interaction that gives rise to experience, in all situations, including art.


No worries Pop. I think you're qualifiedly wrong here, wrong in spades there, but you hold the fort pretty well. Looking forward to future posts, but frankly, you'll have a very hard time winning me over to this line of thought. Consider: I vigorously defend precisely the opposite of your views. Integrated information's meaning is meaningless without value. All things have their foundational grounding in the aesthetic dimension of our existence, for as Hume said of reason, the same holds for information: in itself, it is empty. This is why Dewey had the right approach, just the wrong ideas. The aesthetic is not wrought out of pragmatic consummatory experiences; rather, the aesthetic is discovered in these.
Wittgenstein opened my eyes to this, in his Tracatus and his Lecture on Ethics. But the issues here have nothing to do with contemporary theory and its infatuation with information.
PseudoB October 05, 2021 at 02:59 ¶ #603977
Reply to Constance
The aesthetic is not wrought out of pragmatic consummatory experiences; rather, the aesthetic is discovered in these.


So the basis of the scientific method being used to validate Experience, would only ensure the solidifying of a grand circular idea??
Pop October 05, 2021 at 03:04 ¶ #603978
Quoting T Clark
It's embarrassing.


What is truly embarrassing is how a dim wit and lack of any substantial argument whatsoever, will not prevent some from expressing their consciousness, mistaking their opinions for something of philosophical worth, like royalty. :lol: Far out!

Most people would understand the first time, but it seems you need to be told again - put up or shut up!
Pop October 05, 2021 at 03:15 ¶ #603979
Quoting Constance
All things have their foundational grounding in the aesthetic dimension of our existence, for as Hume said of reason, the same holds for information: in itself, it is empty.


I would agree that all things have their foundational grounding in experience, which is inherently aesthetic ( is painful or pleasant ). But we can not put the cart before the horse. Before we can have value, or meaning, or aesthetics, we need information - as information is the fundamental observable. It is the first thing we have, through which the other things - value, meaning, etc, emerge and evolve.

I think, we are not so far apart, except perhaps in this understanding of fundamentals.
Constance October 05, 2021 at 03:47 ¶ #603983
Quoting PseudoB
So the basis of the scientific method being used to validate Experience, would only ensure the solidifying of a grand circular idea??


Circular in that a pragmatic theory of knowledge knows no way out. Peirce was the only one who had this "long run" part of his thesis that suggested that affairs in a community of inquirers eventually would resolve in something inevitable, and opposition would be won over. Something like that. Rorty seemed to think something along these lines, holding his liberal irony thesis in which ethical systems would eventually become stable out pure pragmatic necessity. I'd have to read his Contingency, Irony and Solidarity again to recall it well. He said the world is made, not discovered. I think he is both right and wrong.
But look at the scientific method. It is the conditional logical structure of causal events in the world. What is a star, for example? It is, "when one observes a star, certain effects result, and are designated by erms like brightness, distance, doppler red shifts, and so on. Of course, the whole matter is extremely complex, but that is what knowledge is, the "forward looking" anticipation of a thing that predelineates the thing antecedent to encounter. So, to know, is to anticipate what will happen with regard to engagement. This is the hypothetical deductive method, so called. Pragmatists think this is what a knowledge experience is, an event that confirms an anticipation. Circular? There is in this no Hegelian finality.
But then, while I agree that this is what knowledge of object is about, and this is a temporal theory, which has to be the case, I don't believe it is the be all and end all of our being in the world at all.
Tom Storm October 05, 2021 at 04:02 ¶ #603986
Reply to PseudoB Quoting PseudoB
Many have said there is more Truth in the first ten scriptures of Genesis than in all the libraries of the world. To answer the question, “what is Truth”, I can only answer: what has no opposition, and is always, regardless of Experience. Truth accounts for all experience of solidity, where all came from a Water.

I hope I have not overstepped.


Ok now I get where you are coming from. Since we don't share the same worldview or assumptions there's no point me firing anything back.
Constance October 05, 2021 at 04:13 ¶ #603991
Quoting PseudoB
Well, without being too open, I will try to point at it. Reason being because one must invest into the equation, to have a personal experience with the Truth, else one is just taking another’s experience as Gospel, with no personal evidence.

The scientific mind is indeed the closest to the Truth in these days, but on needs to see the relationship between where we came from and how the four Elements function. The relationship of the Elements, in practice, presents as a fire heated seven times hotter than normal.

This furnace is depicted in every Cathedral, and the hints in concrete and metal artwork throughout history. The Key allows for the greening and growing of Splendor Solis, that is also in every business building’s artwork, whether in stone or art.

Once one can see this unspoken Cabala all throughout every aspect of society, as a constant reminder of the renewing of the mind needed to accomplish the Worke.

Many have said there is more Truth in the first ten scriptures of Genesis than in all the libraries of the world. To answer the question, “what is Truth”, I can only answer: what has no opposition, and is always, regardless of Experience. Truth accounts for all experience of solidity, where all came from a Water.

I hope I have not overstepped.


As for me, I don't think you overstep at all. It is rather welcome, and this is because, while I don't attend much to religious scriptures, I do take them seriously as a means of addressing the world at the threshold of thought where the totality of ideas meet their match and simply have to fall away.
I think one always has to keep Wittgenstein in mind. The Good, he said, was divinity, but one may not speak of it. It is a given, and language cannot penetrate this, so one should simply not try to speak of it. This goes to aesthetics, for these feelings and these extraordinary encounters at the threshold of things in music and art are absolutes. Value is an absolute. An unpopular position, but then, everyone else is wrong on this. I would make the point that philosophy can make inroads into religious matters. The way to do this lies with ethics and aesthetics, or, more precisely, metaethics and metaaesthetics. MetaValue! This is at the philosophical core of religion.
Tom Storm October 05, 2021 at 04:14 ¶ #603992
Quoting Pop
What is truly embarrassing is how a dim wit and lack of any substantial argument whatsoever, will not prevent some from expressing their consciousness, mistaking their opinions for something of philosophical worth, like royalty. :lol: Far out!

Most people would understand the first time, but it seems you need to be told again - put up or shut up!


Pop, TC's not the only one here who thinks your idea is empty. But don't make it about him. Abusing the man isn't an argument. Keep your sense of humor about it.

I've long moved on from your argument for reasons I have stated several times. Sounds to me like a few of us just think it is better to move on. No harm done. You've been indefatigable in trying to defend your view. Good for you. I'm just not going to read any more until you find something new to say.
PseudoB October 05, 2021 at 12:59 ¶ #604099
Reply to Constance
I think one always has to keep Wittgenstein in mind. The Good, he said, was divinity, but one may not speak of it. It is a given, and language cannot penetrate this, so one should simply not try to speak of it.


So can anyone explain why “the Good”, in and of itself, supposes the opposite to have to be?

I understand that most use contrast to justify this, but clearly the Gnostics have found no need to maintain giving life to death. To be clear, I am not set on any particular “religion”. I do however equate the Experience of Solidity whatsoever with Truth, and all Ideas as a Water, thus making much sense, or shall I say, making such Thoth, Thought, sensible, tho clearly Cabalistic in revelation.

This Absolution of Good, presents as an accessible Kingdom, a Realm in which Mind is a realm tainted by Division. This division is maintained throughout all society, and as noted in the scriptures, “a house divided cannot stand”. It may be necessary to maintain a Forceful mindset, but to maintain Humility in a Circle would put Nature under Subjection, and without Force….

Some would call this the Stone.

;)
RussellA October 05, 2021 at 13:28 ¶ #604104
Quoting Constance
I think art is to grounded in the aesthetic, and the aesthetic is to be grounded in affect.


@Constance "Calling an eclair sweet is certainly not a priori"

(y) True. As further described by post-Darwinian "evolutionary aesthetics" and "evolutionary ethics", humans are born with certain innate abilities, in that the brain is not a blank slate. The contemporary word "innate" serves the same purpose as Kant's 18th C word "a priori".

There is a certain ambiguity in the phrase "a priori knowledge". On the one hand it can mean a priori knowledge of the subjective experience of the colour red, sweet taste, aesthetic form, etc. On the other hand it can mean that some people have a genetic predisposition to certain skills and abilities, whether being naturally good at languages, mathematics, people skills, dance, football, etc, where such innate knowledge is not of the goal itself - but an instinctive understanding of how to achieve the goal

IE, it is a priori knowledge of how to achieve a goal rather than a priori knowledge of the goal itself.

[u]@Constance "visual form may elicit the aesthetic...........form itself is not aesthetic"
@Constance "Affect is..............the essential feature of art"
@Constance "I think art is to grounded in the aesthetic, and the aesthetic is to be grounded in affect"[/u]

(y) I agree. Clive Bell proposed the concept of "Significant Form", where "There must be some one quality without which a work of art cannot exist; possessing which, in the least degree, no work is altogether worthless" and "lines and colours combined in a particular way, certain forms and relations of forms, stir our aesthetic emotions".

Commentators write "the origin of the aesthetic emotion is within the object itself", but such explanations are ambiguous. Someone observes an object, and there is something about the particular form of the object that induces an aesthetic experience in the mind of the observer. The thing to note is that the object only has a form that is significant to the observer, not that the object has a significant form that is independent of any observer

IE, "significant Form" exists in the observer, not the object observed.

@Constance "This brings the issue to Wittgenstein and why he refused to talk about ethics and aesthetics"

(y) Wittgenstein wrote in TLP 6.421 "It is clear that ethics cannot be put into words. Ethics is transcendental".

In a sense Wittgenstein refused to talk and ethics and aesthetics, but as Bertrand Russell wrote in the introduction to the Tractatus "Mr. Wittgenstein manages to say a good deal about what cannot be said, thus suggesting to the sceptical reader that possibly there may be some loophole through a hierarchy of languages, or by some other exit".

In a letter to Bertrand Russell, Wittgenstein complained that the British philosopher did not understand the main message of theTractatus. He explained that “the main point is the theory of what can be expressed by propositions—i.e., by language . . . and what cannot be expressed by propositions, but only shown; which, I believe, is the cardinal problem of philosophy”

But in practice, philosophers have made reasonable livings from teaching and writing books about aesthetics and ethics, so it cannot be as clear cut as Wittgenstein suggests.

It is interesting fact that I know for certain that my private subjective experience of the sweet taste of an eclair and aesthetic form are the same as yours, as much as I know that there is a cup of tea on the table in front of me.

So how is it that communication using language is possible, using public words such as sweetness of taste and aesthetic form, where such public words refer to private subjective experiences that can never be described in words.

So how do I know for certain that my private subjective experience of aesthetic form is the same as your private subjective experience of aesthetic form, when the only thing they have in common is the public word "aesthetic form".

User image

Using only six pictures, I believe the meaning of "togavata" would be generally understood, sufficient to be able to classify the final picture on the far right as either "togavayat" or not "togavata"

IE, I cannot describe my private subjective experience of "togavata", yet I can relatively easily communicate my private subjective experience of "togavata" by attaching a public word to it.

Language is thereby able to communicate private subjective experiences by linking public words to them, thereby allowing language to be used to communicate private subjective experiences, whether aesthetic form, sweetness of taste, the pain of a headache, etc.

IE, Wittgenstein could have sensibly talked about aesthetics and ethics by linking public words to his private experiences of them.
Constance October 05, 2021 at 14:17 ¶ #604117
Quoting Pop
But we can not put the cart before the horse.


Not to provoke, but just a quick note: this cart before the horse? The real construction of horses and carts lies in the hor-ca-se-rt. This is phenomenology. Dewey was close to this, but like I said, he missed the boat...or cart.
PseudoB October 05, 2021 at 14:19 ¶ #604118
Reply to Tom Storm so if I understand our differences, the core issue is that I see a nonphysical, spiritual core, if u will, behind all Experience, whereas you do not…. Am I correct here?

But all Experience is based on perception, which is the same but different for all. The reality of things sensible being made of things not sensible, proves to be indisputable, once one recognizes that what we are able to sense is limited only by our beliefs, which are non sensible in and of themselves. Their final product is sensible but the belief itself is not. It is merry thought, or spirit, however one wants to word it.

I know many see the “invisibles” as Descriptors of some thing presented to the senses, as attributes of some preexisting Matter, but it is just as rational to say that those “attributes” are what makes up the Experience of Matter.
Constance October 05, 2021 at 14:35 ¶ #604124
Quoting PseudoB
So can anyone explain why “the Good”, in and of itself, supposes the opposite to have to be?

I understand that most use contrast to justify this, but clearly the Gnostics have found no need to maintain giving life to death. To be clear, I am not set on any particular “religion”. I do however equate the Experience of Solidity whatsoever with Truth, and all Ideas as a Water, thus making much sense, or shall I say, making such Thoth, Thought, sensible, tho clearly Cabalistic in revelation.

This Absolution of Good, presents as an accessible Kingdom, a Realm in which Mind is a realm tainted by Division. This division is maintained throughout all society, and as noted in the scriptures, “a house divided cannot stand”. It may be necessary to maintain a Forceful mindset, but to maintain Humility in a Circle would put Nature under Subjection, and without Force….

Some would call this the Stone.


Lots of metaphors in there. Perhaps you could say it in straight prose. Doing this, using language with as much clarity as possible, without yielding to dogmatic clarity, which I think is what analytic philosophy has done, is the only way to reveal the idea.
On dogmatic clarity: this is the insistence that meaning is confined to the accessible, familiar language possibilities. Alas for this as an abiding principle, the world is not like this at all. It is a mystical place, to put it flatly, the foundations of which are intimated as revelatory. This is why I don't condemn such talk as yours as blatantly obscurantist. It is obscure, but the world is obscure at the level of basic questions. But this doesn't mean we shouldn't try our best to clarify---not at all. This clarifying what is at a distance from what language can say clearly is philosophy's job.
PseudoB October 05, 2021 at 14:57 ¶ #604129
Reply to Constance
This clarifying what is at a distance from what language can say clearly is philosophy's job.


I am with Boethius, in describing what is Philosophy? Basically our Philosophies determine what is Sensible to us.

But here again, the Experience of Solidity is only justified by the existence of Truth, imo, yes, but I see no other possibility.
Constance October 05, 2021 at 15:05 ¶ #604132
Quoting PseudoB
But here again, the Experience of Solidity is only justified by the existence of Truth, imo, yes, but I see no other possibility.


But what does this mean? Solidity? Truth? These are meaningless without context, even if the context is talk about acontextuality, which would need further discussion. Explanations can be a way to terminate explanations, in Occam's razor fashion. But this has to be, well, explained, laid clear.
PseudoB October 05, 2021 at 15:16 ¶ #604138
Reply to Constance
Ok, I see Truth and “fact” as different. I see Truth as that which “is”, regardless of Experience. I understand “fact” to be an honest depiction of personal Experience. So the Experience of Solidity, would be contrasted by the Experience of Liquid or even Air (which is water in different degrees). But the Experience does not necessitate the Belief. Rather, the belief necessitates the Experience. Thus presenting us with a Science of Manifestation. Which does in fact give us an explanation of lying manifestations, appearing Real. Also shines Light on why this understanding is utterly required to escape a “lower realm” that is divided and doomed to destruction, imo.
PseudoB October 05, 2021 at 16:14 ¶ #604153
Truth, being that which is, regardless of Experience, this Truth provides for the Experience of Realms of Belief. From here, Newtonian laws of motion apply more to “invisibles”, just as stated in Hebrews 11:1-3 kjv.

This “key”, opens a Door, that once shut cannot be opened and once opened (understood) cannot be shut (ignored).

This Key and this Door, if applied to the Four Elements and their Relationships, are a Furnace, by which to purify Gold. Some would say, to MAKE Gold, to Transmute what appears as Lead initially, into the Experience of Gold.

Knowledge of BOTH good and evil, provides for the Experience of BOTH. This divided house cannot stand, in that it does decay, does, gets lost, stolen, etc. Without the knowledge of evil, the Experience would in fact be impossible, however the Fire required to put the fires under subjection is “insanely” hot….
praxis October 05, 2021 at 17:34 ¶ #604183
Quoting Pop
Claiming that art is an expression of consciousness in no way contradicts aestheticism.
— praxis

I don't wish to say that art is not aesthetic, plainly it is. However all experience is aesthetic, so to focus on aesthetics as the defining feature that separates art from everything else is an error.


Aestheticism emphasizes aesthetic value and effects. It doesn’t deny other positions so this can’t be said to be a definition of art. What are you thinking?!

Quoting Pop
So art is information about the artist's consciousness (hopefully you understand consciousness a little more broadly by now).


I might understand your ideas about it if you were to ever expand on them. When asked, you mention various various philosophies and belief systems, some of which appear to contradict things you’ve said, but don’t explain your ideas in any depth.

Quoting Pop
Yes art is aesthetic … You can not, and you have not put forward any arguments or propositions that define art in terms of aesthetics


Apparently I don’t need to.

Quoting Pop
… most pertinent element of all art - that it is information about consciousness. This makes all art meaningful, as an expression of consciousness, regardless of anybody's personal preferences or motives, or understanding.


Every expression is meaningful regardless of art. I can demonstrate this fact. Try to communicate something to me that is meaningless.

You have failed to show how claiming that art is an expression of consciousness contradicts (“is a thorn in the side of”) aestheticism.
Tom Storm October 05, 2021 at 18:58 ¶ #604202
Quoting PseudoB
so if I understand our differences, the core issue is that I see a nonphysical, spiritual core, if u will, behind all Experience, whereas you do not…. Am I correct here?


No one has any knowledge of the non-physical, do you? I don't have any knowledge of how all experience functions - does anyone?

I notice you point to faith - the best definition of this is the excuse people give for believing something when they have no good reason. Are you here to preach or evangelise?
PseudoB October 05, 2021 at 19:33 ¶ #604209
Reply to Tom Storm I am a writer Tom. My writing helps me work out mysteries. Helps me see things that otherwise remain hidden to myself, because it’s then placed right in front of me. Yes, some may call it Faith, but that is only the initial step in belief in something one cannot sense. From there tho, it is surely a Science, which, as I have found, is quite like our laws of motion according to Newtonian physics, applied to “invisibles”. I refer back to Scripture all the time because just as Constance has said, it is the meeting place of reality and thought or ideas, and this Science is rejected by the masses simply because they don’t believe a physics of matter has any effect of things immaterial. As you have said, you don’t believe anything immaterial exists, basically. Yet, I bet you believe in Momentum! Lol, immaterial, yes, but clearly has effects on material things. We are taught this is an attribute of Matter, but what I see is Ingredients of Matter. What hinders this are the beliefs we are born into the Momentum of. Trying to overcome these presents as a “fire heated seven times hotter than normal”. So the language provides the connections necessary, the meanings, etc. Quite scientifically, just upside down and backwards.
PseudoB October 05, 2021 at 19:38 ¶ #604210
Reply to Tom Storm as to Experience of anything non physical, yes sir, I have had many such experiences. I have had dreams that end up playing out exactly. How I could have known the exacts of the most non meaningful things, months ahead of time, is an impossibility that our science of the day has left me with giant holes to fill in. Whereas other Philosophies have given a very scientific explanation, when understood nonphysically.
Tom Storm October 05, 2021 at 19:49 ¶ #604211
Quoting PseudoB
I am a writer Tom.


I'm sorry to hear that.

Quoting PseudoB
As you have said, you don’t believe anything immaterial exists, basically.


No - I said no one has any knowledge of non-physical things. A different nuance entirely.

Quoting PseudoB
Yes, some may call it Faith, but that is only the initial step in belief in something one cannot sense. From there tho, it is surely a Science, which, as I have found, is quite like our laws of motion according to Newtonian physics, applied to “invisibles”.


Well, you quoted Hebrews 11, not me. So you seem to be calling it faith.

Anyway... back to art.
PseudoB October 05, 2021 at 20:20 ¶ #604215
“Art” has always given a form to that which has no specific form. Beauty comes in all shapes and sizes. So does Death. So does Fear. So does Love. All invisibles, that, like Life, have infinite forms, but their essence or spirit is one. Life grows. Death consumes. As I understand things, us giving life to death is the cause of the momentum of iniquity, the belief of lies, that provides us all with an experiential realm which confirms our core beliefs by hiding them from us and keeping us focused on the forms it takes. You could be a bit more patient and less frustrated with me and my faith. Funny how Death prefers to even kill that which gives it life. But I’d be glad to kill Death :)
PseudoB October 05, 2021 at 20:31 ¶ #604217
Seems to me the hardest part in killing the Experience of Death, in all its forms, is the Work it takes to overcome the beliefs that allow for the Experience. The person u were before reading this is no longer the same. Technically a part of you has died, by merely reading this. Call it an assault? Maybe. But if it leads to a better and more thorough understanding of the whole, then how can I deserve to be punished? At some point a stand must be taken, else one commits philosophical suicide.
Pop October 06, 2021 at 05:54 ¶ #604372
Quoting Constance
Not to provoke, but just a quick note: this cart before the horse? The real construction of horses and carts lies in the hor-ca-se-rt. This is phenomenology. Dewey was close to this, but like I said, he missed the boat...or cart.


Not really sure what this means. Nevertheless, I am impressed with your energetic, and enthusiastic, philosophy. If you don't mind, I would like to tell you why I hold the fort pretty well. My understanding is based in systems theory, constructivism, enactivism, integrated information theory, and yogic logic. Half of these are main stream science, and the other half are about to be, and Yogic logic agrees with a lot of it. They have an information theoretic running through them, which I am in the process of understanding. They create a picture of everything existing as interactive systems and subsystems in an enmeshed and interdependent evolutionary process. This mix of theoretical understanding unifies and integrates very well, and can be used to understand almost any system or situation, from complex financial systems, to tiny simple microorganisms.

As I see it, most contemporary understanding is based on a mix of these theories, spiced up with insight and data from here and there. Such as this theory of individuality released last year. Unfortunately most understanding on this forum is rather old - being based on old philosophy that did not have the benefit of these theories, or the contemporary view that information is something fundamental. Most of this older philosophy is fundamentally flawed in this way, and as a result so is the understanding that is based on it. This is largely my opinion, which I thought I'd share with you if you are interested. I thought it might be something you might want to look into as a way to strengthen your philosophy, by expanding it to incorporate an information theoretic. Of course it is hardly my place to tell you what to do. :smile:
Pop October 06, 2021 at 07:45 ¶ #604383
Quoting Tom Storm
Pop, TC's not the only one here who thinks your idea is empty. But don't make it about him. Abusing the man isn't an argument.


Your mate thinks he is entitled to troll this thread with vacant opinions, as if it was a facebook post or something. It is very low standard, and can hardly be called philosophy. It must be the fifth time he has made the same vacuous comment. I think I have been very patient in my response to people although most of the time the OP answers their questions, provided they make genuine enquiries. But I will not tolerate histrionic whinging and whining, or backhanded derision without reciprocating.

Your mate did not understand what a scientific definition of art even means. It means that the definition is relevant for all art ever made, regardless of culture, from the furthest past, to the most distant future. It also means it can be easily falsified - you can provide a work of art which the definition does not capture. I point out in the definition proof that this is not logically possible, and I would have thought most people of normal intelligence would understand this, but it seems not.

I'm sorry you find such things as a scientific, irreducible, and falsifiable definition of art empty, but I am aware of flat earthers, Q Anoners, New world orders, etc, so nothing much surprises me.
Tom Storm October 06, 2021 at 07:46 ¶ #604384
Reply to Pop :rofl:
RussellA October 06, 2021 at 08:15 ¶ #604390
Quoting Pop
They have an information theoretic running through them, which I am in the process of understanding.


For my own knowledge:

Is Norbert Wiener's 1950 The Human Use of Human Beings: Cybernetics and Society relevant to your position - where art is just a part of patterns of information within the world ?

Also, is the article Dissecting landscape art history with information theory 2020 in the Proceedings of the National Academy of Sciences of the United States of America relevant to your position - whose approach at a meta-narrative is that of a quantitative understanding of a landscape painting rather than a qualitative one ?
praxis October 06, 2021 at 15:18 ¶ #604457
Quoting Pop
I will not tolerate histrionic whinging and whining, or backhanded derision without reciprocating.


Speaking of melodrama.

Quoting Pop
Your mate did not understand what a scientific definition of art even means. It means that the definition is relevant for all art ever made, regardless of culture, from the furthest past, to the most distant future.


That’s super cool and all, but what use is it? You claim that it will put art back into the hands of intellectuals and artists, and put a thorn in the side of aestheticism, but can’t explain how. I hope you realize how clownish this makes you look.

Constance October 06, 2021 at 18:01 ¶ #604491
Quoting Pop
Not really sure what this means. Nevertheless, I am impressed with your energetic, and enthusiastic, philosophy. If you don't mind, I would like to tell you why I hold the fort pretty well. My understanding is based in systems theory, constructivism, enactivism, integrated information theory, and yogic logic. Half of these are main stream science, and the other half are about to be, and Yogic logic agrees with a lot of it. They have an information theoretic running through them, which I am in the process of understanding. They create a picture of everything existing as interactive systems and subsystems in an enmeshed and interdependent evolutionary process. This mix of theoretical understanding unifies and integrates very well, and can be used to understand almost any system or situation, from complex financial systems, to tiny simple microorganisms.

As I see it, most contemporary understanding is based on a mix of these theories, spiced up with insight and data from here and there. Such as this theory of individuality released last year. Unfortunately most understanding on this forum is rather old - being based on old philosophy that did not have the benefit of these theories, or the contemporary view that information is something fundamental. Most of this older philosophy is fundamentally flawed in this way, and as a result so is the understanding that is based on it. This is largely my opinion, which I thought I'd share with you if you are interested. I thought it might be something you might want to look into as a way to strengthen your philosophy, by expanding it to incorporate an information theoretic. Of course it is hardly my place to tell you what to do


Heh, heh, careful what you call old. Speaking for myself, the post, post modern works that have a lineage that reaches back to Kant, through, Hegel, Kierkegaard, Husserl, Heidegger, Levinas, Derrida, and into the current French Husserlians who examine the phenomenological reduction of Husserl, like Jean Luc Nancy, Michel Henry and others; and, speaking of yoga, the way the reduction aligns with, explains phenomenologically, yogic practices (yoga, from the Sanskrit meaning, to join. I suspect when you talk about yoga logic, you have this in mind. Keep in mind, the point here is to establish a union with something ultimate and profound), as well as others contributions.
I read through The information theory of individuality you provided a link for, about half way through. I find this:

Shannon did not describe entropy in terms of heat flow and work but in terms of information shared through a channel transmitted from a signaler to a receiver. The power of information theory derives in part from the incredible generality of Shannon’s scheme. The signaler can be a phone in Madison and the receiver a phone in Madrid, or the signaler can be a parent and the receiver its offspring. For phones, the channel is a fiber-optic cable and the signal pulses of light. For organisms the channel is the germ line and the signal the sequence of DNA or RNA polynucleotides in the genome

The virtue of this concept seems to lie in the way it describes the fluidity and interference in passing from one agency to another of some quantity, the original form of which is entropically diminished, distorted, etc. in transmission. The "information" designates a wide variety of possibilities, from sound vibrations across a wire to hereditary biological features found genetic material.

Such a concept even applies to the preservation of the self in time: how much is actually preserved of this constructed self in the transmission of self in time from past through to future? The self is in decay, or, each moment is an entropic loss of the previous, and perhaps a reconstruction: the self is thereby defined as a fluid reconstruction of information, what Husserl called predelineation: We live in an adumbration of the past that is presented in eidetically formed predicated affairs, to use his language. I find this interesting, and perhaps I will look into it.

My trouble, as I read through this, is that it is entirely a quantifiable analysis. Aesthetics is not quantifiable, or it is (in some hedonic scheme), but this is not the point; the point is, quantifying is altogether absent of the quality, and aesthetics is all about quality. All talk about complex transmissions of information may be true, as the actuarial tables are true for people selling insurance, and no one can say such tables are false, or wrong. They're not. But then, life and death qualitatively has nothing whatsoever to do with actuarial tables. This is why your announcement that art in information offends others here. They think art is profound, religious, or deeply meaningful. Others look to the meanings in play, how truth connects to images, how images are iconographic reflections of the self; and so on.

To me, it is a bit like looking at the human condition and its most meaningful dimension, and saying, well, what does the actuarial table say? You may be right, I mean, the table might be a true account. But how is this quantitative account even remotely adequate?



praxis October 06, 2021 at 19:17 ¶ #604506
Quoting Constance
My trouble, as I read through this, is that it is entirely a quantifiable analysis. Aesthetics is not quantifiable, or it is (in some hedonic scheme), but this is not the point; the point is, quantifying is altogether absent of the quality, and aesthetics is all about quality. All talk about complex transmissions of information may be true, as the actuarial tables are true for people selling insurance, and no one can say such tables are false, or wrong. They're not. But then, life and death qualitatively has nothing whatsoever to do with actuarial tables. This is why your announcement that art in information offends others here. They think art is profound, religious, or deeply meaningful. Others look to the meanings in play, how truth connects to images, how images are iconographic reflections of the self; and so on.


Strange take, I don’t know anyone who is offended by an actuarial table, or anyone who’s not emotionally affected by artistic quality.
Constance October 06, 2021 at 20:57 ¶ #604540
Quoting praxis
Strange take, I don’t know anyone who is offended by an actuarial table, or anyone who’s not emotionally affected by artistic quality.


I cant match what you say here to what I wrote. They are wildly different.
praxis October 06, 2021 at 22:38 ¶ #604586
I'll go through it step by step.

Quoting Constance
talk about complex transmissions of information may be true, as the actuarial tables are true


You compare Pop's claim that "Art work is information about the artist’s consciousness" with actuarial tables.

Quoting Constance
life and death qualitatively has nothing whatsoever to do with actuarial tables


If the experience of life and death has nothing to do with actuarial tables, then the experience of art has nothing to do with Pop's claim.

Quoting Constance
This is why your announcement that art in information offends others here.


An announcement that is compared to actuarial tables. If an actuarial table has nothing to do with the experience of life and death then it would not be offensive to that experience.

Quoting Constance
They think art is profound, religious, or deeply meaningful.


These are experiential qualities, and whoever 'they' are, experience art as profound, religious, or deeply meaningful. This has "nothing whatsoever" to do with Pop's claim so it's strange that you say it's offensive.





Constance October 06, 2021 at 22:47 ¶ #604589
Quoting praxis
These are experiential qualities, and whoever 'they' are, experience art as profound, religious, or deeply meaningful. This has "nothing whatsoever" to do with Pop's claim so it's strange that you say it's offensive.


What is art? Information.

What is life and death? An actuary table.

I thought this clear: The latter is meant to be analogous to the former in that it takes something qualitatively distinct and reduces it to terms quantitative. Read the part where I talk about this.
praxis October 06, 2021 at 22:57 ¶ #604597
Reply to Constance

If something has “nothing whatsoever” to do with qualitative distinctiveness then why should it offend?
Pop October 06, 2021 at 23:37 ¶ #604612
Quoting Constance
Such a concept even applies to the preservation of the self in time: how much is actually preserved of this constructed self in the transmission of self in time from past through to future? The self is in decay, or, each moment is an entropic loss of the previous, and perhaps a reconstruction: the self is thereby defined as a fluid reconstruction of information, what Husserl called predelineation: We live in an adumbration of the past that is presented in eidetically formed predicated affairs, to use his language. I find this interesting, and perhaps I will look into it.


The idea of the mass - energy - information equivalence principle is picking up steam, and understanding things as an evolving process is the obvious way forward. All of that philosophy you mentioned was conceived at a time before it was understood that information is fundamental, so there is an awful lot of philosophical meat on offer, in reinterpreting it via an information theoretic.

Quoting Constance
My trouble, as I read through this, is that it is entirely a quantifiable analysis. Aesthetics is not quantifiable,


That particular theory uses Shannon information theory, but others, including myself, are looking toward a non quantifiable theory of information, where information is a fundamental non-quantifiable observable.

Quoting Constance
This is why your announcement that art in information offends others here. They think art is profound, religious, or deeply meaningful. Others look to the meanings in play, how truth connects to images, how images are iconographic reflections of the self; and so on.


Many would not understand information or consciousness beyond their dictionary meanings. I think the one's that do have no problems with the definition. Academia is coming around to the understanding that information is fundamental - is equal to energy and matter. As this understanding grows so will understanding of my definition, I don't expect this any time soon of course. :lol:

Quoting Constance
To me, it is a bit like looking at the human condition and its most meaningful dimension, and saying, well, what does the actuarial table say? You may be right, I mean, the table might be a true account. But how is this quantitative account even remotely adequate?


It needn't be about actuarial tables at all. Nothing changes for human Being, other than the understanding that everything is information, from every perspective. It is a little like Wit's word game, but a notch deeper to become the information game - both physical and mental.
Constance October 06, 2021 at 23:44 ¶ #604617
Quoting praxis
If something has “nothing whatsoever” to do with qualitative distinctiveness why should it offend?


"But then, life and death qualitatively has nothing whatsoever to do with actuarial tables. This is why your announcement that art in information offends others here. They think art is profound, religious, or deeply meaningful. Others look to the meanings in play, how truth connects to images, how images are iconographic reflections of the self; and so on."

Talk about actuary tables in matter of life and death is about an affect neutral response to something that carries great significance for people. The idea is, of course, intended to refer to occasions of life an death outside of contexts where actuary tables are relevant and expected. This much does rely on the reader's discernment.
Anyway, since I hold that art is essentially about an aesthetic response, about affect, and affect is a qualitative distinction, then having the principle feature of the definition of art to be quantitative, and altogether excluding qualitative properties, is absurd.
Pop October 07, 2021 at 00:13 ¶ #604630
Quoting RussellA
Is Norbert Wiener's 1950 The Human Use of Human Beings: Cybernetics and Society relevant to your position - where art is just a part of patterns of information within the world ?


Cybernetics is part of the enquiry, and is something I have only begun to research about a month ago.
It seems about this time we lost the traditional definition of information - which is to inForm - literally change the shape of, including shape of mind. This definition of information is not present in any of the dictionaries or Wikipedia, which presses my paranoid buttons.

Information and it's definition is an enormous topic. That it is something fundamental - equal to energy and matter, and challenges all understanding.
Constance October 07, 2021 at 00:17 ¶ #604632
Quoting Pop
That particular theory uses Shannon information theory, but others, including myself, are looking toward a non quantifiable theory of information, where information is a fundamental non-quantifiable observable.


This is where you have to comes to terms with reality: The only non quantifiable theory of information there can be, is the art experience itself. You have, in my thoughts, arrived at the critical point: To the extent that a theory is non quantifiable, it is the very embodiment of the quality it is supposed represent. I wonder, what could this be? A poem? Or am I completely missing something?

Qualities are demonstrable. Information that conveys, transmits, carries qualities, elicits aesthetic responses itself.

Quoting Pop
Academia is coming around to the understanding that information is fundamental - is equal to energy and matter


Energy and matter are just place holders for metaphysics, as I see it. Information presupposes these, just as it presupposes metaphysics.
Pop October 07, 2021 at 02:29 ¶ #604670
Quoting RussellA
Dissecting landscape art history with information theory 2020


Thanks for the link, I wasn't aware of it. Shannon information theory can quantify information ( produce a number ), but it is not meaningful in any ordinary sense. I am looking for a theory of meaningful information, of which Pierce's theory of pragmatic information would be close, but also Integrated information theory as a definition of consciousness is good. I believe, there is opportunity to create a theory of information, since no single satisfyingly theory currently exists.

This emergent understanding of information was critical to this definition of art. Wit could not find something singular that all art is, and in his time information was something one exchanged with the neighbors over the back fence. We now know definitively that all art is information - since information is fundamental. The only question that then remains for art is - information about what? And the obvious answer is consciousness. The term consciousness captures the mind activity that leads to the creation of art, and how the art is limited only by the consciousness that creates it - which when we look at art across cultures, and through the ages, seems so obvious. To me at least - :lol: - but it has the consequence of ruffling feathers, since we all know exactly what art is! - right?

The artist interacts with the medium such that he inForms it. The medium in turn informs the viewer. the viewer in turn informs somebody or something else, etc. This is roughly the information flow, and the end result is a change in form of somebody or something - don't ask me more - still trying to work it out myself. :smile:
Pop October 07, 2021 at 02:58 ¶ #604677
Quoting Constance
Energy and matter are just place holders for metaphysics, as I see it. Information presupposes these, just as it presupposes metaphysics.


:up:
Pop October 07, 2021 at 03:27 ¶ #604687
Quoting Constance
This is where you have to comes to terms with reality: The only non quantifiable theory of information there can be, is the art experience itself. You have, in my thoughts, arrived at the critical point: To the extent that a theory is non quantifiable, it is the very embodiment of the quality it is supposed represent. I wonder, what could this be? A poem? Or am I completely missing something?


There is truth in this, but it is really the wrong thread for it. Note my definition does not define the form of art, experience, or consciousness - these are left open ended. It defines art in terms of what leads to it, and how this is what it expresses - namely integrated information.

Regarding the broader implications of your statement: Stuart Kauffman: "In POE we argued that Shannon’s [2] classical definition of information as the measure of the decrease of uncertainty was not valid for a biotic system that propagates its organization. The core argument of POE was that Shannon information “does not apply to the evolution of the biosphere” because Darwinian preadaptations cannot be predicted and as a consequence “the ensemble of
possibilities and their entropy cannot be calculated [1].” Therefore a definition of information as
reducing uncertainty does not make sense since no matter how much one learns from the information
in a biotic system the uncertainty remains infinite because the number of possibilities of what can
evolve is infinitely non-denumerable. I remind the reader that in making his definition that Shannon
specified that the number of possible messages was finite."

Shannon information does not apply to biotic or natural systems, since they are endlessly variable and open ended. Biotic systems are more like evolving bodies of information, where consciousness is the latest state of integrated information, and this would always be experiential.
praxis October 07, 2021 at 03:37 ¶ #604690
Quoting Pop
This emergent understanding of information was critical to this definition of art. Wit could not find something singular that all art is, and in his time information was something one exchanged with the neighbors over the back fence. We now know definitively that all art is information - since information is fundamental. The only question that then remains for art is - information about what? And the obvious answer is consciousness. The term consciousness captures the mind activity that leads to the creation of art, and how the art is limited only by the consciousness that creates it - which when we look at art across cultures, and through the ages, seems so obvious. To me at least - :lol: - but it has the consequence of ruffling feathers, since we all know exactly what art is! - right?


No. For example, an artist pins a banana to a wall and says that it’s art. Many people agree that it’s art, but many others disagree that it’s art. How does your definition help in this situation?
RussellA October 07, 2021 at 16:04 ¶ #604851
Quoting Pop
We now know definitively that all art is information - since information is fundamental. The only question that then remains for art is - information about what? And the obvious answer is consciousness.


(y) I can see that Integrated Information Theory and Peirce's Theory of Pragmatic Information would be relevant to the meaning of art, and should therefore be considered.

I walk along a path and see a few blown pieces of coloured paper on the ground, making a shape that appeals to me. I pick them up, put them in a frame and hang it on my wall. One year later, happening to visit MoMA, I notice exactly the same image as on my wall, but titled Matisse CutOut. As the two artworks are identical, the artistic quality of the artwork must be independent of whatever created it. I don't care whether the artwork was created by a 20 year old or a 80 year old, was French or Peruvian, had a headache or was worried about paying the rent, in that whatever created the artwork is irrelevant in the recognition of the object as an artwork.

It is true that i) to be conscious is to be conscious of something, ie, intentionality ii) consciousness creatively organises information iii) the observer of the artwork is conscious of receiving information from the artwork, shapes, colours, relationships, etc.

@Pop - i) "art work is information about the artist's consciousness" ii) "art conveys.........the consciousness of the artist" iii) "art's function is to express our consciousness". Summarising, the artwork expresses the consciousness of the artist.

But an actuary table is not art, and a Matisse CutOut is art. Therefore there must be a conscious act of determining what is art and what isn't. If whatever created the object is irrelevant in the recognition of the object as an artwork, and the object itself cannot determine that is an artwork, then the conscious act of determining the object as an artwork must be in the observer.

But the observer only knows that the object is an artwork by recognizing it as an artwork, regardless of the intentions of whatever made the object.

IE, looking at the object as an artwork is an expression of the ability of the observer to recognize an object as an artwork, rather than any expression of the observer's ability to look into the mind of whatever made it.
Pop October 08, 2021 at 04:17 ¶ #605035
Quoting RussellA
But an actuary table is not art, and a Matisse CutOut is art. Therefore there must be a conscious act of determining what is art and what isn't. If whatever created the object is irrelevant in the recognition of the object as an artwork, and the object itself cannot determine that is an artwork, then the conscious act of determining the object as an artwork must be in the observer.

But the observer only knows that the object is an artwork by recognizing it as an artwork, regardless of the intentions of whatever made the object.

IE, looking at the object as an artwork is an expression of the ability of the observer to recognize an object as an artwork, rather than any expression of the observer's ability to look into the mind of whatever made it.



An actuary table can be deemed to be art, since Duchamp's urinal, but not before, and this reflects how our collective consciousness has evolved. Before it is art, it has to be deemed to be art. The person deeming it to be art is the artist. If you find something on the ground and pick it up and put it on your wall as an art work, thus deeming it to be art, then you are the artist. Your mind set sets you apart from all those others who walked passed the object not noticing it or thinking it rubbish. So it is still the same situation - You made the choice that this is art, and the artwork in some sense represents your mindset - your consciousness.

This would not have been possible in Jane Austin's England. If you hung a piece of rubbish on your wall - you would be carted off to the nut house. You could only hang ideal landscapes, or if you could afford it portraits. And Sir please refrain from hanging any radical romanticism - what on earth are you thinking of, do you wish to bring down the social order? :lol:

My point is that consciousness evolves both collectively and individually and art reflects this. Consciousness has infinite potential, and although at any time we think we are well on top of it, we are always only scratching the surface. Currently there is potential for a major shift in paradigm through the realization that information is fundamental. This will eventually lead to panpsychic paradigm, not any time soon of course, but the smart cookies can see it coming, so are positioning themselves, imo. There is enormous potential for new art through this understanding, and, If this is somthing that interests you, then it is something I would encourage you to consider.
praxis October 08, 2021 at 06:38 ¶ #605074
Quoting Pop
This would not have been possible in Jane Austin's England. If you hung a piece of rubbish on your wall - you would be carted off to the nut house. You could only hang ideal landscapes, or if you could afford it portraits.



My point is that consciousness evolves both collectively and individually and art reflects this.


It’s not news that culture and art develop. The issue highlighted in the example is that hanging a piece of rubbish on the wall could be seen as a reflection of the mind that put it there, or information about someone’s consciousness, at any point in history or in any culture. It may or may not be seen as art, therefore your definition doesn’t define art. Don’t you see?

If you wanted to explain it to Georgian era gentry how the rubbish is art you would need to include the concept of aesthetic experience in order to reference and try to shift their aesthetic appreciation.
RussellA October 08, 2021 at 08:20 ¶ #605097
Quoting Pop
Before it is art, it has to be deemed to be art.


Suppose a person is conscious of the information arriving through their senses from two objects in the world.

For what reasons would that person deem one object to be art and the other object not art ?
Pop October 08, 2021 at 21:49 ¶ #605217
Quoting RussellA
Before it is art, it has to be deemed to be art.
— Pop

Suppose a person is conscious of the information arriving through their senses from two objects in the world.

For what reasons would that person deem one object to be art and the other object not art ?


Ha, ha. This is something you would have to ask the person deeming one object art, and the other one not. But there would be reasons, or in other words something about their state of mind or thinking ( consciousness ) would result in such an action. Because consciousness is "integrated information", the choices people make are congruous with their general state of mind, so when they make the choice that something is art this is an aspect of their general mind activity, and in an ideal setting we should be able to infer a lot of their mind activity from the clues provided in what they choose as their art. This of course is an ideal situation I'm describing, that cannot be achieved completely, but this is exactly what happens in that Van Gogh clip provided earlier. Even to the extent that Van Gogh is judged to be one of the best people to have ever walked the earth.

I should do some art criticism threads, to explore what can be inferred about the mind activity that made the work, from the work alone. Do you think something of the sort would be of interest?
RussellA October 09, 2021 at 16:20 ¶ #605354
Quoting Pop
what can be inferred about the mind activity that made the work, from the work alone


(y) Anything about art is interesting.

(y) As regards, Integrated Information Theory, I tend to panprotopsychism as an explanation rather than panpsychism.

There is a flow of information - but in what direction ?

I agree that art, especially the aesthetic in art, is a fundamental expression of human consciousness, and art is information, but the question is, in what direction is this information flowing ?

The answer is different for Modernism and Postmodernism

In Modernism, which uses aesthetic form of pictographic representation, as soon as the artist has completed the artwork, the artwork takes on a meaning independent of the artist.

In Postmodernism, which uses symbolic representation, the meaning of the artwork remains tied the artist.

There is a difference between the "maker artist" and the "observer artist"

You write (quote 1) "to explore what can be inferred about the mind activity that made the work" and (quote 2) "you would have to ask the person deeming one object art, and the other one not.....................in an ideal setting we should be able to infer a lot of their mind activity from the clues provided in what they choose as their art".

Quote 1) is about the maker of the artwork as artist. Quote 2) is about the observer of the artwork as artist. Generally writings about art don't make the critical distinction between the person who made the artwork and the person who recognises an object is an artwork. My position is that there is no fundamental, philosophical, metaphysical difference between the "observer artist" and the "maker artist". The person who sees an object and recognises it as an artwork is as much an "artist" as the person who made the artwork. The only differences are practical, in that the "maker artist" has certain skills that the "observer artist" doesn't.

This skill that has taken many years to learn separates the "maker artist" from the "observer artist". The person who appreciates the artistic quality of a Van Gogh has the same artistic appreciation as Van Gogh himself, the difference being that Van Gogh had a profound skill and technical ability in the making of an artwork, whether conscious or instinctual, that most people can never approach.

IE, the difference between an admirer of a Van Gogh and Van Gogh himself is not of artistic sensibilities but of technical skill.

Postmodernism

In Postmodernism, information must flow from the artist that made the artwork to the observer of the artwork, and such information must flow separate to the artwork.

For example, Carl Andre's Bricks, where the meaning of the brick as a symbol cannot be discovered in the symbol itself, but only in the mind of the maker of the artwork.

Modernism

You write "to explore what can be inferred about the mind activity that made the work". I would argue that it is impossible to discover from a Modernist artwork anything about the mind of the maker of the artwork for the following reasons:

1) Some artworks have two or more makers, such as the collaborative work of Ruth Lozner and Kenzie Raulin. To which mind does the artwork have insight into ?
2) Some artworks are ambiguous, such as Monet's St Lazare Station. Is Monet referring to progress in the 20th C or the interplay of light onto physical objects ?
3) Some artworks have no artist makers, only observer artists, for example Warhol's Brillo Box
4) The same artist may paint in completely different styles, such as Van Gogh's early and late period.
5) Different artists may have painted in the same style, such as the Fauves. Vlaminck having a reputation as a loudmouth, troublemaker, and womanizer, whilst Matisse had a conservative appearance and strict bourgeois work habits.
6) The same artist, such as Briton Riviere, may paint a scene of despair Fidelity or of joyful humour Geese
7) Picasso painted Guernica at his home in Paris away from the bombings in Spain, whilst Monet painted Water lilies to the sounds of war.
8) An atheist may paint a religious scene, as Francis Bacon's Crucifixion and the Pope, whilst a religious person may paint a secular scene, such as Caravaggio
9) Interpretation of an artwork is open to debate. Robert Frost's The Road Not Taken is popularly generally taken as a poem about hope, success, and defying the odds, whereas it is in fact the opposite.
10) A contemporary performance of a Mozart piano sonata uses a different type of piano to that used by Mozart, meaning that the modern concert goer is hearing a different sound to that intended by the composer, meaning that a modern performance cannot be expressing what was in the composer's mind.

IE, there is a practical impossibility for the observer to discover links from the artwork into the mind of the artist.

Summary - information cannot flow from the maker of the artwork to the observer via the artwork.

The direction of flow of information is a crucial consideration in art.

In Modernism, which uses aesthetic form of pictographic representation, as soon as the artist has completed the artwork, the artwork takes on a meaning independent of the artist. Information flows between the maker of the artwork and the artwork, between the artwork and the observer of the artwork, but cannot flow from the maker of the artwork to the observer via the artwork.

In Postmodernism, which uses symbolic representation, the meaning of the artwork remains tied to the artist. Information flows between the maker of the artwork and the artwork, and from the maker of the artwork to the observer of the artwork by-passing the artwork entirely, but cannot flow from the maker of the artwork to the observer via the artwork.

Pop October 10, 2021 at 01:11 ¶ #605459
Quoting RussellA
There is a flow of information - but in what direction ?


This is not the ideal thread for this, but since you asked, the nature of information is something I am still trying to understand. However thus far I understand it to be something that is accumulative and irreversible - It's direction of momentum can be altered but not be reversed, thus everything evolves as an accumulative informational body.

Just roughly, the artist is informed by experience, and in interacting with the art work inForms it, likewise the medium informs the artist - that there is a limit to their ability and skill :smile: Something is created , and then this something is interpreted by the viewer. Suppose this something is an archeological artefact, a figurine, quite a lot can be inferred about the thinking of the person that made it, depending on what is depicted and how and from what materials, within the historical context that it was made in. If this figurine is not information about the mind activity that created it - what then is it information about? We know it is information, since everything is fundamentally information.

This same situation applies to all art ever made, and all things ever made. However as you point out, context makes a difference, but once we account for this, the art is still information about the artist's consciousness, just in a different context, no?

Quoting RussellA
Information flows between the maker of the artwork and the artwork, and from the maker of the artwork to the observer of the artwork by-passing the artwork entirely, but cannot flow from the maker of the artwork to the observer via the artwork.


No, this does not make sense in my mind. The information flows much the same as this message. I inform the message, and then you interpret the message. In the process you receive a sense of how my mind works, and visa versa.

Quoting RussellA
1) Some artworks have two or more makers, such as the collaborative work of Ruth Lozner and Kenzie Raulin. To which mind does the artwork have insight into ?


In reality, mostly to the dominant one. But for political correctness lets say their combined thinking.
All of your point form arguments relate to the difficulty of discerning the mind activity of the artist from the art work alone - yes it is very difficult, and often requires some historical knowledge of the artist and the context that the work is created in, but this does not negate the definition. The artist, or a non artist person, can express nothing other than their consciousness. Consciousness is used as a blanket term for mind activity, but if we look into it more deeply, consciousness is an evolving process of "self organization" of an individual. In science "self organization" led to life. In Systems theory, the universe is bottom up "self organizing". So art expresses the same "self organization" that ordered form in the universe expresses - that life expresses, this is a big deal, imo, and this is not going to change anytime soon. :smile:

RussellA October 10, 2021 at 09:14 ¶ #605508
Quoting Pop
So art expresses the same "self organization" that ordered form in the universe expresses


The figurine is an object that can be described as art, was made by a consciousness, where consciousness is a result of some kind of self-organisation, can be described as information and expresses something to the observer.

When someone observes information, the information can only express something to the observer if the observer can make sense of the information, can see patterns in the information, in that the information is not chaotic. IE, information by itself cannot express anything to the observer until the observer is able to see patterns in the information.

The patterns the observer is able to see is a function of the observer's mind, the observer's consciousness, and is not a function of whatever caused the figurine to come into existence.

IE, seeing art in the figurine is an expression of the observer's consciousness rather than any history prior to the creation of the figurine.

(y) This doesn't affect the idea that art is information about the conscious self-organising mind, it just moves the mind from the maker of the object to the observer of the object.
Pop October 10, 2021 at 21:29 ¶ #605691
Quoting RussellA
When someone observes information, the information can only express something to the observer if the observer can make sense of the information, can see patterns in the information, in that the information is not chaotic. IE, information by itself cannot express anything to the observer until the observer is able to see patterns in the information.

The patterns the observer is able to see is a function of the observer's mind, the observer's consciousness, and is not a function of whatever caused the figurine to come into existence.

IE, seeing art in the figurine is an expression of the observer's consciousness rather than any history prior to the creation of the figurine.


Oh, I see now. You are highlighting that the observer interprets the artwork entirely in terms of their own consciousness, and If they had no prior knowledge of art history, they would hardly be in a position to interpret anything. Similarly, If this sentence was written in Swahili, you would not be in a position to understand it. Yes, I agree entirely with this.

In my understanding, information has a chronological progression. It is causal, and I was trying to illustrate this. How the artist informs the work, and the work informs the viewer, and so on. But certainly if the viewer can not understand anything of the work then they are likely to dismiss it as something irrelevant to their understanding, and purpose. :up: ** Likewise what they understand, they understand in terms of established knowledge, or understanding.

RussellA October 11, 2021 at 11:28 ¶ #605856
Quoting Pop
You are highlighting that the observer interprets the artwork entirely in terms of their own consciousness


(y) Yes, "art work is information about............consciousness".

But the only consciousness I have ever known is my own. I assume there are other consciousnesses out there in the world, but I may be wrong, I will never know. Even if there are consciousnesses out there other than my own, I will never have any consciousness of a consciousness that is not my own.

IE, as art is information about consciousness, and the only consciousness that I know exists is my own, art can only be information about my own consciousness.

Quoting Pop
information has a chronological progression. It is causal,


(y) Yes, information flow is chronological.

As regards Postmodernism, there is no information within a brick that gives the viewer information about the state of mind of Carl Andre. As regards Modernism, there is no information within a painting of a sombre scene whether the artist was in a sombre or happy mood when they painted it.
praxis October 11, 2021 at 18:14 ¶ #605909
Quoting Pop
For what reasons would that person deem one object to be art and the other object not art ?
— RussellA

Ha, ha. This is something you would have to ask the person deeming one object art, and the other one not. But there would be reasons, or in other words something about their state of mind or thinking ( consciousness ) would result in such an action. Because consciousness is "integrated information", the choices people make are congruous with their general state of mind, so when they make the choice that something is art this is an aspect of their general mind activity, and in an ideal setting we should be able to infer a lot of their mind activity from the clues provided in what they choose as their art.


A few basic reasons are that either the object wasn’t framed as art, or that the observer didn’t recognize it as art, or that the observer recognizes that it’s framed as art but, evaluated by their own criteria, judges it to not be art.

Significant to your claims, the recognition or evaluation of art has nothing to do with your definition of art that “Art is an expression of human consciousness. Art work is information about the artist’s consciousness.” In order to define something you need to specify it’s unique attributes. Your definition only identifies information and human consciousness, nothing specific to art. It is not a definition of art and has no explanatory power in regards to art.
Pop October 11, 2021 at 23:17 ¶ #606014
Quoting RussellA
IE, as art is information about consciousness, and the only consciousness that I know exists is my own, art can only be information about my own consciousness.


I'm glad we agree that art is information about the artist's consciousness. And when we view art, we do so in terms of our own consciousness. And so when we view an artwork it is an interaction of one consciousness and another, and when these two click, it is one of the best experiences life has to offer.
When they do not click however, then it is another story altogether.

This is what I hoped the definition would highlight, not that one consciousness is better than another, but that a similar consciousness will agree on the form of an artwork, whilst a dissimilar will disagree.

Yes, as your own consciousness grows, as you learn more about any particular artist, or movement, your ability to appreciate them improves. Your ability to asses whether they achieve their aims, and whether their aims have merit, improves.

Most of the time the artist and the viewer draw their information ( which when integrated makes up their consciousness ) from the same collective consciousness ( culture ) so they will understand each other to some extent. But when knowledge of any particular area evolves beyond normal understanding, then a discord occurs. This occurs in all areas, not just art. At some stage the specialist's understanding becomes incomprehensible to normal understanding. Andre would seem to be such a specialist - in an extremely obscure and abstract area of sculpture. Clearly these forms mean something to him, but I don't know anything about him or his thinking so would not like to say more.

Many artist's reach a stage of development where they can no longer be understood by the norm, so they give up totally on that aim. They would still be understood by a handful of people with similar interest and understanding, so they speak to them. To me, this is nothing but a story of how different their consciousness is to the norm. How different is the information that they present compared to the norm. How they don't care about this, or how they do this on purpose in order to differentiate themselves from the norm. And this speaks of little other than how they understand themselves and the world that they live in, and how this is a part of their personality and larger purpose in life.

The information is not so much in the brick, but in the fact that a person who has total freedom to do as they like, chooses to put a brick on a pedestal. This speaks heaps, imo.

David Shrigley, Nobody 2007
https://cdn.artimage.org.uk/production/19/8/19800-842.jpg
Tom Storm October 11, 2021 at 23:21 ¶ #606015
Quoting praxis
“Art is an expression of human consciousness. Art work is information about the artist’s consciousness.” In order to define something you need to specify it’s unique attributes. Your definition only identifies information and human consciousness, nothing specific to art. It is not a definition of art and has no explanatory power in regards to art.


That's for sure, several pages of no particular insight into what art is, as opposed to, say, the act of nose picking - which may also hold information about a person's consciousness.
praxis October 12, 2021 at 04:49 ¶ #606101
Reply to Tom Storm

Completely in character, @Pop completely ignores the fact.

Pop October 12, 2021 at 05:44 ¶ #606109
Quoting praxis
Completely in character, Pop completely ignores the fact.


:roll: For the tenth time, and it is the first paragraph of the definition.

Quoting Pop
Proof of the definition:

?1.   Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.






RussellA October 12, 2021 at 10:20 ¶ #606175
Quoting Pop
The information is not so much in the brick, but in the fact that a person who has total freedom to do as they like, chooses to put a brick on a pedestal.


Perhaps this remains the sticking point, in that I tend to Modernism whilst you may be leaning towards Postmodernism. Both valid as definitions of art, but different.

Within Postmodernism, an artist has total freedom to create whatever object, concept, performance they want for it to be called art.

Whereas in Modernism, regardless of the definition of art, some objects have artistic value and some don't, where someone who makes an object with artistic value is an artist and someone who makes an object lacking artistic value isn't an artist.

IE, personally, I don't agree with the Postmodernist definition of art, because the words art and artist lose all meaning, as everything can be art and everyone can be an artist.
Tom Storm October 12, 2021 at 10:29 ¶ #606179
Reply to RussellA Are you going by an account of aesthetics rooted in modernist theory, or are you just using the terms as you see them apply?
RussellA October 12, 2021 at 13:33 ¶ #606223
Quoting Tom Storm
Are you going by an account of aesthetics rooted in modernist theory, or are you just using the terms as you see them apply?


I am distinguishing between modernism and Modernism, whilst defining modernism as art that includes aesthetic quality.

Some reference material includes aesthetics as part of the definition of Modern Art and some don't. Generally they don't. For example, the Tate UK description of Modernism doesn't mention the aesthetic. The V&A article on "What was Modernism" mentions beauty. The Wikipedia article on Modernism has a small reference to aesthetics.

And yet there is The British Journal of Aesthetics which promotes debate in philosophical aesthetics and the philosophy of art.

However, it seems to me that the aesthetic is the primary dividing line within art as discussed today.

Even though not central to contemporary articles on Modern Art, I would argue that every important artwork pre-1960 had aesthetic quality, from the Lascaux cave paintings, through Egyptian, Greek and Roman art, from medieval religious art to Impressionism.

Whereas, I would also argue that no important Postmodern art since the 1960's has had aesthetic quality, partly due to Postmodernism's deliberate exclusion of any aesthetic.

IE, within modernism are many different approaches, as with postmodernism, but for me the primary dividing line within art is the presence or absence of the aesthetic.
Varde October 12, 2021 at 13:50 ¶ #606227
Art is a species bound occurrence.

Like martial arts, special arts exist.

I suppose having human hands and human minds restricts our art.
praxis October 12, 2021 at 15:27 ¶ #606302
Quoting Pop
Completely in character, Pop completely ignores the fact.
— praxis

:roll: For the tenth time, and it is the first paragraph of the definition.

Proof of the definition:

?1.   Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.
— Pop


For the eleventh time, in order to define something you need to specify it’s unique attributes. Your definition only identifies information, human consciousness, and social constructs, nothing specific to art. It is not a definition of art and has no explanatory power in regards to art.
Tom Storm October 12, 2021 at 19:01 ¶ #606364
Quoting RussellA
IE, within modernism are many different approaches, as with postmodernism, but for me the primary dividing line within art is the presence or absence of the aesthetic.


Interesting. Are you someone who thinks art has a responsibility?

Does your perspective risk a subjectivist aesthetic? Is all post-modern art free of aesthetic merit and how does one go about identifying what counts as the aesthetic and what does not?

Post-modern work is likely to have an aesthetic, it just doesn't concern itself with beauty. Modernist (capital M) work like Braque's Cubism has an aesthetic too, but is it beautiful? Cannot something which is 'ugly" (however you define this) not also provide a profound aesthetic experience?

Can you clarify how you would apply your modernist perspective to pre-modern era work? Say a Titian.

Varde October 12, 2021 at 19:24 ¶ #606366
Martial arts is a skill. Painting, Drawing, Sculpting, Creating Audio, or what I call 'special arts', are also skills.

Is there a definition for playing darts? Darts has a definition, but literally playing darts is a skill set which goes undefined.

That rules a majority of the answers in this thread as false.

A painting is a painting, a sketch, a sketch.

Therefore art has no definition; the term art generalises martial art (art style) and special art (art craft). A worthy art term is a philosophical subject matter where we are discussing both art style and art craft.

Art, defined is, the subject matter of martial and special art skills.
Tom Storm October 12, 2021 at 19:46 ¶ #606370
Quoting Varde
Is there a definition for playing darts?


Yes. The very clear rules of what constitutes a darts game. There is even a darts regulation authority.

Quoting Varde
or what I call 'special arts', are also skills.


Just because you call them 'special arts' means little to the rest of the world.

Quoting Varde
Therefore art has no definition


There is a long tradition of aesthetics that would say otherwise. It would probably be more accurate to say there are many, many definitions of art and no agreed upon canonical definition.

Quoting Varde
Martial arts is a skill. Painting, Drawing, Sculpting, Creating Audio, or what I call 'special arts', are also skills.


But one traditional issue in art criticism is how to identify the art as opposed to the skill. Technical skill is often seen as sitting separate from whether something has artistic merit. Pulp fiction author Stephen King is a writer of great technical skill but few would call his work 'art'. Also how do you separate art from craft? Another traditional distinction.

Pop October 12, 2021 at 21:54 ¶ #606417
Quoting praxis
in order to define something you need to specify it’s unique attributes


Quoting Pop
Art is an ungrounded variable mental construct: Objects are arbitrarily deemed to be art. Art’s only necessary distinction from ordinary objects is the extra deemed art information. Art can be anything the artist thinks of, but this is limited by their consciousness.


Why is this so hard for you to understand? -"Art’s only necessary distinction from ordinary objects is the extra deemed art information". Once something is deemed to be art, my definition comes into effect. Please read the definition and the earlier posts before posing the same question again.
praxis October 12, 2021 at 23:48 ¶ #606461
Quoting Pop
Why is this so hard for you to understand?


Why is it so hard for you to be honest?

“Alter-Pop”:Xuit is an ungrounded variable mental construct: Objects are arbitrarily deemed to be xuit. Xuit’s only necessary distinction from ordinary objects is the extra deemed xuit information. Xuit can be anything the xuitist thinks of, but this is limited by their consciousness.


What is Xuit? You don’t know because I haven’t defined it.
Pop October 12, 2021 at 23:53 ¶ #606464
Reply to praxis Good luck with it. :up:
praxis October 13, 2021 at 00:19 ¶ #606472
Reply to Pop

Xuit has nothing to do with luck. Go ahead and take another guess.
Pop October 13, 2021 at 23:02 ¶ #606892
Quoting RussellA
Perhaps this remains the sticking point, in that I tend to Modernism whilst you may be leaning towards Postmodernism. Both valid as definitions of art, but different.

Within Postmodernism, an artist has total freedom to create whatever object, concept, performance they want for it to be called art.

Whereas in Modernism, regardless of the definition of art, some objects have artistic value and some don't, where someone who makes an object with artistic value is an artist and someone who makes an object lacking artistic value isn't an artist.

IE, personally, I don't agree with the Postmodernist definition of art, because the words art and artist lose all meaning, as everything can be art and everyone can be an artist.


This definition can be used to argue that art only has one definition, and that it is valid across all cultures for all of time, as it identifies a logical constant in art, which is it's most important consideration, and without which art could not exist. So it can be used to argue that art has a definition in Post Modernism. This would put a spanner in the works of some post modern thinking, as it would identify how it is incoherent to believe art is for art's sake, as it is always information about the artists consciousness, regardless of whether they understand this to be the case or not. Anybody can deem an object to be art, but they can not engage in this activity beyond what their consciousness allows, so this identifies a limit to what art can be for any particular artist. We need to bear in mind that art has infinite potential, as an expression of a potentially infinite consciousness, but it only ever comes in finite form.

Art can not be defined externally via form, as it is potentially infinite, but it can be defined internally via the process that leads to it's creation, and how this places a limit on what it can be. We can define art by what creates it, rather then it's eventual result.

The only thing that is constant in art is that it is information about the artists consciousness – everything else is variable and open ended. It takes some appreciation that this is the only thing tying one piece of art to another in the absolute sense. The unearthed ancient artefact and a Pipilotti Rist light show have this in common, these are expressions of a person's consciousness in regard to art, at particular times in history. In the future, art might be expressed directly via a Neuralink type of device, but it will still be captured by this definition, no?

Consciousness is unique and particular. It is made of information - from DNA information, experiential information, and perspective (relativity). This information, composes an individual, and they can do nothing other than express this information. They do so when making art. Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism. The information in the artwork is understood in terms of the information possessed by the observer, to create what we normally call consciousness. If this is so, then where is the sense in trying to separate the artwork from the consciousness of it's maker? There is no sense in this is there? If the observer is completely enacted / interacted in the artwork, then the maker is surely more so. So what is the art work an expression of in all cases?

There is a neat trick to illustrate the Enactivist cognitive interaction: Thesewordsandyouareone - for a brief second these words and you are one - there is no possibility to separate you from these words as you read them - your consciousness, at present, is made up from the interaction of the information that composes you and these words. Apply this logic to the making of an art work, where there is no difference between and artwork and the consciousness of it's maker for an extended period of time, sometimes years, and it is easy to see how art is always an expression of consciousness, and how this internally defines it, in the most pertinent terms. And how all other considerations are miniscule and trivial compared to this one.
RussellA October 14, 2021 at 14:07 ¶ #607057
Lots of questions.

Quoting Tom Storm
Are you someone who thinks art has a responsibility?


No. Neither Derain nor Derain's La Rivière bear any responsibility, no more than an apple sitting on a table bears any responsibility. Though the Derain provides an opportunity.

What the Derain does give is a glimpse that there is something deeper and more profound than what is seen on the superficial surface of shapes and colours, of a figure walking past a house next to a river. The painting achieves this using an aesthetic form of pictographic content. What is hidden is not explained, but what is explained is that there is something hidden.

The aesthetic of art is what separates an airport novel from a Hemingway. Superficially,The Old Man and the Sea is a simple story of Santiago, an ageing experienced fisherman, but concealed beneath the words is a complex allegorical commentary on all his previous works.

We are muggles innocently walking along Diagon Alley, unaware of a hidden and mysterious and magical world just out of our reach, hidden by many powerful spells of concealment, seemingly lacking a key. But with art we do have the key. The key is our innate a priori ability to experience aesthetic form, an ability to discover pattern in seeming chaos, enabling the search and discovery of new understanding and knowledge.

Quoting Tom Storm
Does your perspective risk a subjectivist aesthetic?


I have the subjective experiences of seeing the colour red, hearing a grating noise, tasting something bitter, smelling something acrid, perceiving aesthetic form. These are not risks to my perspective, these are what I am.

Quoting Tom Storm
Modernist (capital M) work like Braque's Cubism has an aesthetic too, but is it beautiful? Cannot something which is 'ugly" (however you define this) not also provide a profound aesthetic experience?


Exactly. Aesthetic is used as an adjective and as a noun.

Aesthetic as an adjective is the study of beauty.

But beauty as a noun surely has a different meaning to aesthetic as a noun. For example, taking the examples of Picasso's Guernica 1937, a moving and powerful anti-war painting, and Bouguereau's 1873 Nymphs and Satyr, mythological themes emphasising the female human body

Dictionary definitions generally agree that aesthetic as a noun means a set of principles governing the idea of beauty, such as "modernist aesthetics" and beauty as a noun means qualities such as shape, colour, sound in a person or thing that gives pleasure to the senses.

Both the Picasso and Bouguereau are important paintings and have aesthetic values. Whilst the Bouguereau may be said to give pleasure to the senses, the Picasso certainly doesn't.

IE, it follows that the aesthetic must be more than being concerned with beauty.

Quoting Tom Storm
how does one go about identifying what counts as the aesthetic and what does not?


There are numerous definitions of the aesthetic, from non-utilitarian pleasure to truth. Articles about aesthetics generally conflate aesthetic with beauty. As an aesthetic object can be ugly, the aesthetic and beauty are two different concepts. Therefore, looking at the Wikipedia article on aesthetics, for example, and removing any conflation between aesthetic and with beauty one is left with the following text:

It examines aesthetic values often expressed through judgments of taste
The word aesthetic is derived from the Greek, pertaining to sense perception.
In practice, aesthetic judgement refers to the sensory contemplation or appreciation of an object (not necessarily a work of art)
Judgments of aesthetic value rely on the ability to discriminate at a sensory level.
Aesthetic judgments may be linked to emotions or, like emotions, partially embodied in physical reactions
.It is said, for example, that "beauty is in the eye of the beholder".
It may be possible to reconcile these intuitions by affirming that it depends both on the objective features of the beautiful thing and the subjective response of the observer.
Classical conceptions emphasize the objective side of beauty by defining it in terms of the relation between the beautiful object as a whole and its parts: the parts should stand in the right proportion to each other and thus compose an integrated harmonious whole.
Aesthetic considerations such as symmetry and simplicity are used in areas of philosophy, such as ethics and theoretical physics and cosmology to define truth, outside of empirical considerations

Summarising the above - when observing a particular object in the world using the senses of sight, hearing, etc, and experiencing a particular subjective emotion or feeling brought on by a judgement that the parts of the object are combined in the right proportion to make a harmonious whole, then this is the aesthetic. In my terms, the aesthetic is a discovered unity within an observed variety.

Quoting Tom Storm
Is all post-modern art free of aesthetic merit ?


Postmodernism included art, beauty and aesthetics in their attack on contemporary society and culture. As yet, there is no unified postmodern aesthetic, but remain disparate agendas, as discussed in Hal Foster's The Anti-Aesthetic: Essays on Postmodern Culture.

As every object has a temperature, but not to the same degree, every object is an artwork, has beauty and has an aesthetic, but also not to the same degree. Even though Monet's Waterlily and a train timetable have an aesthetic, a Monet Waterlily has a greater aesthetic merit than a train timetable.

As the postmodernists have no agreed definition of the aesthetic, it is difficult to say whether or not postmodernism has an aesthetic of merit.

As regards my understanding of the modernist concept of the aesthetic - a discovered unity within an observed variety - postmodernism is free of modernist aesthetic merit, mainly because it has been a deliberate act on the part of the postmodernists to remove any modernist aesthetic.

Quoting Tom Storm
Can you clarify how you would apply your modernist perspective to pre-modern era work? Say a Titian.


User image

Sentient life is thought to have started during the Cambrian Period, 541 mya to 485 mya and modern humans evolved from archaic humans 200,000 to 150,000 years ago.

It seems clear to me that the pre-1950 examples of art have features in common, and these features are different to the post 1950's examples. In fact, the pre 1950's examples could have been created by the same artist. As regards representation, pre 1950's is pictographic and post 1950's is symbolic. As regards aesthetic form, pre 1950's exhibit a distinct aesthetic quality whilst post 1950's minimise aesthetic quality.

The modernist style of the Modernist movement goes back to at least to the Lascaux cave paintings, painted by modern humans about 20,000 years ago. IE, the modernist style is not new, but is a feature of modern human art.
RussellA October 14, 2021 at 14:57 ¶ #607073
Quoting Pop
Then the art interacts with an observer, and as you point out, this is an inextricable interaction of a consciousness acting upon the artwork and in turn artwork acting upon the consciousness of the observer. It makes no sense to try to separate this interaction in enactivism.


The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.

IE, how can consciousness interact with itself.



Tom Storm October 14, 2021 at 18:57 ¶ #607134
Quoting RussellA
The aesthetic of art is what separates an airport novel from a Hemingway. Superficially,The Old Man and the Sea is a simple story of Santiago, an ageing experienced fisherman, but concealed beneath the words is a complex allegorical commentary on all his previous works.


Thanks for your lengthy response. This is key I think to art discussions. Art (whatever it might be) is separate to craft or technical proficiency.

I studied aesthetics at university briefly (theory derived primarily from Monroe Beardsley) and it is clear that more bullshit is written about art than, even religion. My own interest is mainly the art from antiquity - I worked for a prestigious dealer in ancient Greek, Roman, Etruscan and Egyptian antiquities some decades ago and I remain haunted and tantalised by what I saw.

An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest. A work doesn't have to be good to be called art. This is the one thing people (often wilfully) overlook.
Pop October 14, 2021 at 22:10 ¶ #607227
Quoting RussellA
The word "interact" seems problematic.

Someone observes an artwork, the person becomes conscious of the artwork and the artwork becomes part of the person's consciousness. How can the person consciously interact with the artwork when the artwork is now already part of the person's consciousness. It is not as if one part of the person's consciousness is being conscious of another part of the same person's consciousness.
IE, how can consciousness interact with itself.


This is what Enactivism tells us.
"Enactivism is a position in cognitive science that argues that cognition arises through a dynamic interaction between an acting organism and its environment.[1] It claims that the environment of an organism is brought about, or enacted, by the active exercise of that organism's sensorimotor processes. "The key point, then, is that the species brings forth and specifies its own domain of problems ...this domain does not exist "out there" in an environment that acts as a landing pad for organisms that somehow drop or parachute into the world. Instead, living beings and their environments stand in relation to each other through mutual specification or codetermination". - Wikipedia

What information is , is a huge and contended topic in itself. I have understood it as an interaction, consistent with enactivism, and systems theory.

Sketched roughly and simply: Information causes a change in neural state. When we look in any direction, we see a picture already coloured in and symbolized subconsciously, whilst science tells us that no colour exists in the external world. We then interact with this symbolized picture. In cognitive science, a Markov blanket presents us with this initial perception, and then other similar processes act on this in a sequential fashion to eventually arrive at some resolution . This reveals how it is then quite easy to insert imagined or memorized input into the process rather than external sense derived information, and how consciousness is the result of this information processing and integrating. In short it makes no sense to think of an organism absent of it's environment, and likewise it makes no sense to think of art absent of the artist, or as you point out, the observer. We need that interaction for information to occur, and in the process of integrating that information consciousness occurs, and clarity about what is going on emerges, and action results, etc. The information flows in this way, as I envision it, due to interactions, and the result is that everything is enmeshed, codependent, codetermined, and coevolving, on absolutely all scales.

RussellA October 15, 2021 at 08:08 ¶ #607422
(y)Quoting Tom Storm
An artwork is an object produced with the intention of giving it the capacity (for some person somewhere, at some time) to satisfy the aesthetic interest.


User image


RussellA October 15, 2021 at 16:07 ¶ #607522
Quoting Pop
In short it makes no sense to think of an organism absent of it's environment


(y) Totally agree.

This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42)

This approach also seems similar to evolutionary aesthetics and ethics, where the basic aesthetic and ethical preferences of Homo sapiens are argued to have evolved in order to enhance survival and reproductive success. A topic initiated by Charles Darwin's The Descent of Man and developed by Herbert Spencer.

Enactivism and the analogy of the sand dune
A particle of sand is subject to forces from other sand particles and the wind, meaning that the dynamic interaction between the sand particles and wind brings about the formation of sand dunes. The sand dune evolves because of an dynamic interaction between the particles of sand and their windy environment. The sand dune cannot be understood absent from its environment. The movement of any particular particle of sand is determined by the forces acting on it from surrounding particles of sand and the wind, a deterministic cause and effect. The particles are organised into sand dunes by the physical nature of each particle and the wind acting on them.

IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment.

Information about a thing is an extrinsic property of the thing
The evolution of a sand dune is driven by a complex set of wind forces on a complex set of particles of sand. A single mass may be expressed in terms of information, weight, location, etc. A single force can be expressed in terms of information, direction, strength etc, but such information is an extrinsic property of the force rather than an intrinsic property. Therefore, any effect of the force is not determined by any information that can be expressed of the force. Therefore, the evolution of the sand dune is determined by the forces and particles of sand, not by any information that may be expressed of the forces or of the particles of sand.

IE, evolution cannot be driven by information
James Riley October 15, 2021 at 16:22 ¶ #607526
I'd say art is the objective absense of waste. All other waste, present or absent, is subjective.
Pop October 15, 2021 at 23:29 ¶ #607707
Quoting RussellA
IE, the particles of sand may be thought of as the brain's neurons, and the the sand dune may be thought of as the conscious mind. As enactivism proposes that the mind/consciousness has arisen from a dynamic interaction between the neurons of the brain and its environment, we could also say that enactivism also proposes that the sand dune has arisen from a dynamic interaction between the particles of sand and its windy environment.


:up: Yes, that is a good way of putting it. @Gnomon illustrates something similar here.

Quoting RussellA
evolution cannot be driven by information


It depends on what you understand information to be. Incredibly in this "information age" we do not have a universally agreed upon definition of information. :grimace: I have understood information to be equal to interaction. In the sand dune analogy, all those gazillions of interactions that eventually self organize to a sand dune are information. Ie: information is identical to interaction, and can be thought of as evolutionary interaction. This might explain it better, and this.

Quoting RussellA
This seems similar to Kant's concept of the "synthetic a priori". Kant wrote in Critique of Pure Reason - "The objects we intuit in space and time are appearances, not objects that exist independently of our intuition (things in themselves). This is also true of the mental states we intuit in introspection; in “inner sense” (introspective awareness of my inner states) I intuit only how I appear to myself, not how I am “in myself”. (A37–8, A42)


Kantian idealism would probably agree with the understanding that everything is information, although he couldn't have been aware of the neural correlates of perception in his time, so would have probably understood information as something changing an immaterial mind. If we accept neuroplasticity and the idea that perception entails a physical change in brain state, then all information can be understood in a universally applicable and regular way - as a change causing physical interaction. This message is not something you can passively just receive - initially it changes your brain state, which causes further neural interaction, until the process resolves to some clarity.

To illustrate just briefly: My physical brain state, causes a change to the physical keyboard state, which causes a change to the computer hardware state, which causes a change to various internet routers, which cause a change to your device, which causes a change to your brain state. So information is a "change causing interaction universally", in my understanding.
RussellA October 16, 2021 at 12:04 ¶ #607994
Quoting Pop
It depends on what you understand information to be


Although slightly digressing, the following is relevant to "The Definition of Art".

As @Mark Nyquist noted, something that may be overlooked is the definition of the word definition.

On the one hand @Banno wrote "definitions are not all that helpful", but on the other hand
writes about InPhO that "the potential is extraordinary". Yet InPhO is founded on the definition. Barry Smith in the video How to Build an Ontology says that the three steps are 1) you create an ontology which in the simplest possible terms is a controlled vocabulary of labels, 2) you provide logical definitions for those labels so that you can compute using the labels and 3) and then you tag the data using those terms typically you tag the data with URI's addresses

Without definitions, communication would be impossible. If I asked someone to pass me the salt, and they did not know the meaning of salt, rather than tell them to read Salt: A World History by Mark Kurlansky, a more useful approach would be to say that salt is a white crystalline substance that gives seawater its characteristic taste and is used for seasoning or preserving food.

It is true as you say that "It depends on what you understand information to be", in that sometimes the same word can mean different things to different people, but without the "principle of charity" communication would become impossible.

Perhaps the reader should treat the writer's words and phrases more like idiomatic expressions than literal descriptions. Often a phrase has a meaning independent of the words used, as "in my job interview I had to jump through hoops", where neither jumping nor hoops were involved.

I fully accept the concept behind Kant's "synthetic a priori", though disagree with the word synthetic being used in combination with the word a priori, in that I have decided to treat synthetic a priori more as an idiomatic expression that a literal description. Similarly with "I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions I fully agree with them, even if I may have a different opinion as to the particular choice of words, ie, information and self organisation.
Pop October 17, 2021 at 02:45 ¶ #608184
Quoting RussellA
"I have understood information to be equal to interaction" and "I am an evolving process of self organisation". As idiomatic expressions


:up: Yes, these expressions are idiomatic to my evolving understanding of information and consciousness. They are based on established theory, but my personal interpretation of it. You have agreed with more than I would normally hope for, so I am pleased overall.

As you say, in communication, some degree of charity is necessary, and given some charity I think the definition would normally pass. However I wouldn't normally expect charity in regard to a "definition" of art, so I had to test the definition by developing a deeper understanding of both consciousness and information. Both neglected and contented concepts in western thought. It turns out they are related concepts, in that consciousness at any moment is a state of integrated information, that exists as an evolving process, for the purpose of self organization. Again this is not a universal understanding, but idiomatic to my personal understanding of Systems Theory, Constructivism, Enactivism, IIT, and aspects of Yogic logic, and the emergent understanding that information is fundamental - which will, imo, challenge a lot of established understanding about information, amongst many other things.
RussellA October 17, 2021 at 10:17 ¶ #608226
Quoting Pop
emergent understanding


As you mentioned consciousness and emergence, I wonder if the sand dune analogy gives any insights.

If the observer is aware of the particles of sand, force of the wind on them and the resultant form of the sand dunes, they would explain the shape of the sand dunes as an example of "weak emergence". But, if the observer was only aware of the particles of sand and the resultant form of the sand dunes, they would explain the resultant shape of the sand dunes as an example of "strong emergence".

Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness.

In practice, we observe a strong emergence of the mind/consciousness from the neurons of the brain. Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence.

The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism.
Pop October 18, 2021 at 00:36 ¶ #608466
Quoting RussellA
Following the analogy, the particles of sand are the neurons of the brain, and the resultant form of the sand dune is the mind/consciousness.


Yes, that is how I would describe it also. The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form. Absolutely everything can be described in the same terms, as form resulting from historical interactions. If we understand these interactions as information ( where information is an inForming ), then everything can be described as an evolving informational body, where the latest form of said body is it's integrated information, and integrated information is equal to consciousness. Obviously our consciousness is far more complex and far more advanced then a sand dune so far more conscious, but it results from the same informational / interactional process.

Quoting RussellA
The obvious answer would be quantum entanglement, but I feel that most discussion about consciousness uses quantum mechanics either as obfuscation or obscurantism.


The quantum foam lacks form, as it is random and probabilistic, however once a wavicle integrates it's information with another wavicle, then the informing process begins and can continue to amass to elementary particles, atoms, molecules, and so on. The pattern of the physical arrangement of the atoms
gives rise to different materials, or forms. In the end all these different forms emerge, but from the same process.

Quoting RussellA
Perhaps we are missing a force acting on the neurons of the brain of which we are presently unaware. If we could discover this missing force, the mystical problem of strong emergence would become an understandable problem of weak emergence.


:up: Yes, or put another way - it is a self organizing universe, but what is the source of self organization?
RussellA October 18, 2021 at 14:10 ¶ #608582
I know what you mean, and I don't want to unnecessarily quibble about words, but the choice of word does have an effect.

Quoting Pop
but what is the source of self organization?


Yes, where is Force X ?
The problem of strong emergence would be reduced to that of weak emergence if we could discover the missing force acting on the neurons.

Quoting Pop
If we understand these interactions as information


In snooker, a cue ball hits a coloured ball at rest. I can describe the system before the interaction by knowing information about the position of interaction, initial cue ball speed and direction. I can describe the system after the interaction by knowing the information about the final cue ball speed and direction, coloured ball speed and direction.

There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ?

Quoting Pop
The sand dune can be described as a system, and the wind another system, and through interaction they self organize to a form.


Organising
1) I can organise books on a shelf - the books don't self organise.
2) A computer can organise numbers into increasing size - the numbers don't self-organise.

1) The snooker cue doesn't organise the final resting position of the snooker balls - the final resting position is a consequence of deterministic cause and effect.
2) The wind doesn't organise the final form of the particles of sand - the final form of the sand dune is a consequence of deterministic cause and effect.
3) Force X doesn't organise the final form of the neurons - the final form of consciousness is a consequence of deterministic cause and effect.

IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect

Self-organising
At the start of a game of snooker, a snooker cue hits a cue ball which hits a coloured ball, and eventually the snooker balls come to rest.

1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ?

Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X
Pop October 18, 2021 at 23:25 ¶ #608795
Quoting RussellA
There is information about the system before the interaction, and there is information about the system after the interaction.

Is it valid to say that the interaction itself is information ?


Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness.

1. Potential information exists in the book on a shelf

2. Actual information occurs when we read it - interact with it.

3. Consciousness occurs when this interaction is integrated with past informational structure - ( knowledge in constructivist fashion ).

Quoting RussellA
IE, organisation requires a rational process, whether that of a conscious person or that of a non-conscious computer, rather than be a consequence of a deteministic cause and effect


Books on a shelf, etc, are an expression of your self organization, rather then the book's self organization. Leave the book in the weather for a time and then it will "self" organize. The organization I am referring to is intrinsic self organization. Everything exists as an evolving process of self organization, so changes over time, due to interactions, including rocks. Nothing stays still and permanent, in the absolute sense.

Quoting RussellA
1) Is it valid to say that the snooker balls interacting with the applied force of the snooker cue have self-organised themselves into their final resting position ?

2) Is it valid to say that the particles of sand interacting with the applied force of the wind have self-organised themselves into their final sand-dune form ?

3) Is it valid to say that the neurons interacting with unknown "Force X" have self-organised themselves into their final conscious form ?


Yes in all these cases self organization has occurred. And you would be asking - if this is the case than who or what does the thinking? It is something I wonder about also. :grin: In my understanding, Information is self organizing, and thus self integrating. Interactions self organize to an integrated form, and all that exists, exists as an artefact of this process. The symbolic self is an artefact of evolutionary neuroplasticity.

Quoting RussellA
Conclusion
Once conscious, the conscious mind can then organise - books on a shelf etc
But, as consciousness is the consequence of deterministic cause and effect of Force X on neurons, consciousness cannot be the determinant in organising the final form of the neurons when interacting with Force X


Yes, the source of self organization is what does the thinking. Is it the anthropic principle - the combined laws of the universe causing everything to self organize? Is it god? This is where the philosophy gets interesting. Once you decide on the source of self organization, you close off other possibilities and commit yourself to a theory of everything which forms your reality.

In Yogic logic ( my interpretation ) the source of self organization is consciousness. This is a wise move, where consciousness is left as something undefined and fundamental - where everything and everybody is, at heart, made of the same stuff, just different in Formation :grin: Reality here has infinite potential, it can continue to evolve beyond what can currently be conceived, and the self organizing information theoretic remains logically coherent.
RussellA October 19, 2021 at 10:33 ¶ #608955
Sentient life is estimated to have evolved on Earth during the Cambrian period about 541 mya to 485 mya. The start of the Universe is estimated at about 13.8 billion years ago. Before sentient life evolved on Earth, physical objects changed with time - lava flowed down the sides of volcanos, rocks bounced down the sides of mountains, etc.

Quoting Pop
Is it valid to say that the interaction itself is information ?........Yes it is absolutely valid. You have posed a reformulation of Schrodinger's cat problem, which cannot be known until the box is opened. The wavefunction is probabilistic / potential information, when interacted with it's potential is collapsed to a point, which gives rise to a moment of clarity - which is consciousness


Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ?

Pop October 19, 2021 at 23:15 ¶ #609188
Quoting RussellA
Does this mean that prior to the evolution of sentient life on Earth, if two rocks (or pebbles, atoms, elemental particles) hit each other, ie, interacted, then at the moment of interaction the wave function collapses giving rise to consciousness ?


Basically yes, but we have to bear in mind we have conceptualized consciousness to a state of integrated information. What you describe is a situation where that state is disturbed, and then reintegrated again. Fritjof Capra states "cognition is a disturbance in a state", and everything is a system in a state, according to systems theory. However there is a world of difference between the interaction of two molecules, and the interactions of 24 million molecules making up an average human cell, and then 30 odd trillion of such cells making up human consciousness. So we are talking about very different results indeed, however they are the same in terms of information having been disturbed and reintegrated.

In systems theory we can take any part of the universe, such as the biosphere and know that it is made up of self organizing interacting subsystems all the way down to plank length and perhaps beyond. For things such as rocks, they require a physical interaction for their total information to change, for sensing organisms however this physical change of state can occur due to a perception of a change in their environment.

RussellA October 20, 2021 at 13:54 ¶ #609415
Quoting Pop
at the moment of interaction the wave function collapses giving rise to consciousness ?................Basically yes


Koch wrote "By postulating that consciousness is a fundamental feature of the universe, rather than emerging out of simpler elements, integrated information theory is an elaborate version of panpsychism"

Meaning of "integrated"
On observing a system, such as "an apple on the table" my consciousness about "an apple on the table" is integrated. IE, in that a conscious experience is unified and irreducible, in that seeing a blue book is not reducible to seeing a book without the colour blue, plus the colour blue without the book.

Meaning of "information"
Consciousness is specific. Each experience is composed of a specific set of phenomenal distinctions, a blue colour as opposed to no blue colour, no bird as opposed to a bird.

My consciousness is expressed by my "neural state"

a) On observing a system, for example, "an apple on the table", I am conscious of the information contained within the state "an apple on the table".
b) Suppose the system changes
c) On observing the new system, "no apple on the table", I am conscious of the new information contained within the state "no apple on the table".

In @Pop's terms:
1) "information causes a change in neural state"
2) "information is not something static, but something dynamic"
3) "information is the interaction of physical form"

In my terms:
1) The change in information causes a change in neural state.
2) Information is static, a change in information is dynamic.
3) As regards "information", the observer of the system is conscious of information about the system. As regards "interact", the physical form of the observed system interacts with the physical form of the brain's neural state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

The problem of information as fundamental
Taken from John Searle's criticism of Tononi and Koch explanation of Integrated Information Theory

"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness. Either the information is carried by a conscious experience of some agent (my thought that Obama is president, for example) or in a non-conscious system the information is observer-relative - a conscious agent attributes information to some non-conscious system (as I attribute information to my computer, for example)"

"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder"

Art, aesthetics and information
The observer may have information about a piece of art - painted by Andre Derain, dated 1905, titled The Drying Sails, sized 82 × 101 cm.
The observer must be conscious of the artwork in order to know information about it.
The observer has a subjective aesthetic experience when an artwork having a particular physical form interacts with a particular neural brain state - as a cue ball interacts with a snooker cue - a matter of deterministic cause and effect.

IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder".
Pop October 21, 2021 at 02:12 ¶ #609728
Reply to RussellA That is an excellent post :smile: It is such a pleasure to find intelligent and probing conversation.

Quoting RussellA
"We cannot use information theory to explain consciousness because the information in question is only information relative to a consciousness.


If this were true then we couldn't use information to explain anything, as everything is relative to a consciousness. IE: it is not art that we speak of but our consciousness of art - perhaps a concept that exists slightly differently in our respective minds, as per all concepts. So it is important to have definitions that we agree on, and to be able to pose concepts in the third person perspective ( in the empirical objective tradition), such that we can engage with the concept purely intellectually, and then incorporate it, or not, into our personal perspective.

We can pose a concept of how information works in the empirical tradition and then decide on whether this makes sense or not.

Quoting RussellA
"Koch and Tononi wrote that "the photo-diode's consciousness has a certain quality to it", but the information in the photo-diode is only relative to a conscious observer who knows what it does. The photodiode by itself knows nothing. The information is all in the eye of the beholder"


Much of this speculation exists outside of a definition of information. If information is understood as evolutionary interaction, then the interactions that led to the forming of a photo diode could be understood as a creation of an informational body in a certain form, that interacts with other informational bodies of certain form, and they change each others form in the process of information / interaction. Posed this way we avoid the difficulties of understanding what another informational body in a certain form experiences. Which we cannot know for certain, but if elementary particles are formed due to forces acting on them, then surely they would be feeling those forces? They may not be able to feel those forces in a self aware sense as we do, but there are forces acting on them and they conform to those forces, as we do. Evidently some of those elementary particles eventually form amino acid molecules that self organize to life. Imo, this is deterministic with a slight element of randomness - it is consistent with the accumulative informational body theoretic - that informational bodies can continue to evolve in complexity.

Systems and complexity theory are near enough to a theory of everything.
In Systems Theory; everything = interaction
For a person: everything = information
Therefore interaction = information, where a person is a complex adaptive system.


Quoting RussellA
IE, as "beauty is in the eye of the beholder", then "information is all in the eye of the beholder".


I would say the beholder is a body of integrated information, and the latest state of this is consciousness, and if the latest information integrated is purely visual or auditory, and results in a pleasant feeling, then the chances are that we have witnessed or heard something beautiful. So yes beauty is in the eye of the beholder, but information is something different. If we understand information to be interaction, then information is the change causing interaction between an externality and the integrated body of information - a body that exists entirely as a result of past such interactions, from the biological, experiential, and relative perspectives.

In one respect it does not make sense to say a body exists as a state of integrated information as it is always interacting, changing, and evolving, but in order to deal with it, we need to conceptualize it at some level, and so I conceptualize it to moments of consciousness, that exist as states of integrated information, as per IIT. And then, in those moments of consciousness the information is resolved to some clarity, entirely from the perspective of the integrated information, or as you say the eye of the beholder.

The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from.







RussellA October 21, 2021 at 16:50 ¶ #609921
Quoting Pop
it is not art that we speak of but our consciousness of art


(y) Agree, of the three main epistemological approaches, Idealism, Indirect Realism and Direct Realism, I tend to Indirect Realism. In Indirect Realism, the external world exists independently of the mind, and we perceive the external world indirectly, via sense data. Our subjective experience is private, and even if the object remains the same, our subjective experience may change.

Quoting Pop
it is important to have definitions that we agree on


(y) Yes. It has been said that "definitions are not all that helpful". Accepting that language with definitions is difficult, language without definitions would be unworkable

Quoting Pop
If information is understood as evolutionary interaction


(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information"

Quoting Pop
deterministic with a slight element of randomness


(n) A deterministic system cannot be random, unless one brings in free-will

Quoting Pop
Therefore interaction = information


(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction.

Quoting Pop
yes beauty is in the eye of the beholder


(y) Until the eighteenth century, most philosophical accounts of beauty treated it as an objective quality. Augustine in De Veritate Religione asks explicitly whether things are beautiful because they give delight, or whether they give delight because they are beautiful. He emphatically opts for the second.

Even on the Forum, some still argue that "The observer only uses the act of perception over beauty, but the beauty is still there, regardless of the observer"

Though I'm with Kant, who wrote in The Critique of Judgement -
"The judgment of taste is therefore not a judgment of cognition, and is consequently not logical but aesthetical, by which we understand that whose determining ground can be no other than subjective. Every reference of representations, even that of sensations, may be objective (and then it signifies the real [element] of an empirical representation), save only the reference to the feeling of pleasure and pain, by which nothing in the object is signified, but through which there is a feeling in the subject as it is affected by the representation".

Quoting Pop
The difference is that, whilst beauty is also information, beauty is something the system experiences, whilst information is something the system interacts with and is created from.


The link between what the system experiences and what the system interacts with
David Hume in Moral and Political 1742 wrote "Beauty in things exists merely in the mind which contemplates them.". Is beauty in the thing independent of the observer, or as Hume wrote, in the mind of the observer ?

My strong belief is that there is a direct informative analogy between the observation of an object such as Window at Tangiers by Matisse and a resulting subjective aesthetic experience, and the ability of an opera singer to use their voice alone to shatter a wine glass.

https://www.youtube.com/watch?v=Oc27GxSD_bI

The wine glass shatters. Is it the pitch of the voice that causes the glass to shatter, or is it the shape of the glass that cause the glass to shatter ? It is in fact neither alone, but a resonance between the two, an interaction between the two. In order for the glass to shatter, the voice has to be of one particular pitch and the glass has to be of one particular shape. Resonance is an example of a deterministic cause and effect.

The experience of art requires both a particular artwork and a particular observer, not an artwork alone in the absence of an observer, and not an observer alone in the absence of an artwork. So where is beauty. Beauty cannot exist in an object in the absence of an observer, and beauty cannot exist in an observer in the absence of an artwork. Beauty is a "resonance" between the observer and the artwork.

IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.
Tom Storm October 21, 2021 at 19:02 ¶ #609960
Quoting RussellA
IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.


This seems very prescriptive. May I clarify? Does this mean if I walk up to Rembrandt's Night Watch and have an experience no different to looking at a lunch box lid, the paining does not count as art? And does this mean that art can be any object which causes a mind to resonate aesthetically?
Pop October 21, 2021 at 21:00 ¶ #609994
Quoting RussellA
(n) We have a different definition of "information". I believe that you define it as the dynamic moment of interaction, whereas I define it as the static moment, whether between interactions or at the moment of interaction. For example, I would define "agcactctcacttctggccagggaacgtggaaggcgca" as information"


We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with. whether they be memory, imagination, or sense generated. When exactly consciousness emerges in those moments is hard to say, is it instantaneous, does it slowly resolve during the course of a moment, or crystalize at the end of a moment? I don't know, but I would say during those moments there is a multiplicity of interactions occurring, and they resolve to a singular picture somehow, that we know as consciousness - at that moment the information / interaction has been resolved. As you say, understanding information is important to this, and there is no singular, universally agreed upon, definition.

Quoting RussellA
A deterministic system cannot be random, unless one brings in free-will


Landauer's principle
It holds that "any logically irreversible manipulation of information, such as the erasure of a bit or the merging of two computation paths, must be accompanied by a corresponding entropy increase in non-information-bearing degrees of freedom of the information-processing apparatus or its environment". - Wiki.
This is something that may be relevant to consciousness. In the process of information, as an interaction of one part to another, there is an element of entropy which changes the deterministic nature of the relation, such that a tiny degree of randomness arises - perhaps this is what causes emergence?
Could Landauer's principle explain it?

Perhaps this is free will? :smile:

Quoting RussellA
(n) Considering the system "snooker game", there are periods when the snooker balls interact and there are periods when there are no interactions between the snooker balls. Therefore, in this particular system, not everything is an interaction.


In my understanding, how the snooker balls exist outside of a moment of consciousness and thus an interaction with them, is probabilistic, no matter how certain we may be, as per Schrodinger's cat situation.

Quoting RussellA
IE, art happens, art being a subjective experience of an aesthetic, when an observer having a particular state of mind resonates with a particular objective fact in the world.


:up: So an interaction ( resonance )? Sounds like Enactivism to me?
RussellA October 22, 2021 at 10:36 ¶ #610235
Quoting Tom Storm
art being a subjective experience of an aesthetic...............This seems very prescriptive


I think "art being a subjective experience" is uncontroversial. The question is, what kind of subjective experience. There are many possibilities - beauty, emotion, aesthetic, the expression of will, a mimetic, social comment, etc. However, my personal choice is "the aesthetic", but this is more my definition than a rule.

User image

Quoting Tom Storm
And does this mean that art can be any object which causes a mind to resonate aesthetically?


Yes, it seems so to me. Art can be a novel by Cormac McCarthy, a song by Sade, the film Shooter, the design of the Golden Gate Bridge, the Pyramids, the 1989 Mercedes-Benz 300SL R107, a prawn, chilli and lemon tagliatelle, Einstein's concept of spacetime, etc.

As every object has a temperature, every object is an artwork and has an aesthetic. But that is when quality comes into the equation.
RussellA October 22, 2021 at 15:06 ¶ #610306
Quoting Pop
We can reduce life to moments of consciousness, and then what we are conscious of are the things we are interacting with


An important element of phenomenology that Husserl borrowed from Brentano is intentionality (often described as "aboutness"), the notion that consciousness is always consciousness of something. It is rooted in Brentano's intentionality, in that reality cannot be grasped directly because it is available through perceptions of reality that are representations of it in the mind. Thoughts, such as beliefs, are directed towards objects, ie, a thought doesn't exist alone.

(n) The problem is how to escape from the circularity. On the one hand, I am conscious of something (an apple) and I interact with it. On the other hand, I interact with something (an apple) and become conscious because of it.

Quoting Pop
Could Landauer's principle explain it?


Landauer's principle can be understood to be a simple logical consequence of the second law of thermodynamics. The second law of thermodynamics states that the entropy of isolated systems left to spontaneous evolution cannot decrease. Entropy is defined as a measure of randomness or disorder of a system.

(n) I see no connection between the randomness or disorder of a system and any consciousness resulting from such randomness or disorder.

Quoting Pop
interaction with them, is probabilistic


Interaction can be thought of in two ways. At a large scale the classical interaction between two billiard balls, and at a small scale the quantum interactions between elemental particles.

If the game of snooker is considered at the small scale, the theory is that an electron for example can have a non-zero probability of being in more than one distinct state, which is the definition of a superposition state, such that particles don’t have classical properties like “position” or “momentum”, but have a wave function, whose square gives us a probability of position or momentum. Defining "interaction" as that at the small scale, then the current theory does say that behaviour is probabilistic, in that quantum mechanics is non-deterministic because of the Heisenberg Uncertainty Principle

(n) Yes, at a large scale, the system may be static, but at a small scale, the system is dynamic. But I see no connection between a dynamic system and any consciousness resulting from such dynamism.

Quoting Pop
So an interaction ( resonance )? Sounds like Enactivism to me?


It does. A quick internet search found an article within the National Library of Medicine by Ryan & Gallagher titled Between Ecological Psychology and Enactivism: Is There Resonance? In their abstract they write "Ecological psychologists and enactivists agree that the best explanation for a large share of cognition is non-representational in kind" and end with "We conclude with future considerations on research regarding the brain as a resonant organ"

(y) Yes, interaction, resonance and enactivism seem important aspects in explaining how the brain functions.
Pop October 22, 2021 at 20:48 ¶ #610447
Quoting RussellA
(n) The problem is how to escape from the circularity. On the one hand, I am conscious of something (an apple) and I interact with it. On the other hand, I interact with something (an apple) and become conscious because of it.


I don't think you can escape this circularity, which is why I say information = interaction.

The Wave function is probabilistic, and is collapsed at the point of interaction. Consciousness exists at the point of interaction, and not outside of it. This illustrates the wave function collapse nature of reality, and suggests consciousness is probabilistic, until collapsed to a point. This would validate the notion that consciousness exists in frames - exists at the point of collapse of probabilistic information.

However, thankfully, new information has to fit old information, in a constructivist fashion. It has to fit existing informational structure. So having an existing body of information seems to keep things on track - to evolve in a deterministic manner, with just a slight element of randomness, to allow for emergent / novel thought, perhaps through Landauer's principle.

Quoting RussellA
(n) Yes, at a large scale, the system may be static, but at a small scale, the system is dynamic. But I see no connection between a dynamic system and any consciousness resulting from such dynamism


I think all systems are enmeshed and dynamic at all scales - they are moving and evolving always, due to codependent interactions. These interactions are equivalent to information. Certainly for sensing organisms these interactions constitute information. However, I do understand one can hardly understand this with the prevailing definitions of information.

It has been good to chat. :up: Unfortunately "reality" has intervened such that I will not have as much time for this for a while, and we have strayed quite a way off topic. :smile:

GraveItty October 22, 2021 at 21:30 ¶ #610457
Quoting Pop
I don't think you can escape this circularity, which is why I say information = interaction.


Interaction (gauge spin 1 or 2 fields) is necessary to let information form, embedded in matter (spin 1/2) fields. The difference between these two is that gauge fields carry massless, pure potential energy while massive matter fields carry pure kinetic energy. The masslessness of gauge fields and basic (the massive W-and Z-bosons are not fundamental and the constituents of quarks and leptons are massless, in bound states giving rise to the massive quarks and leptons; I know, highly speculative, but that's the way it is), their pure potential energy, and the pure kinetic energy of matter fields, gives rise to Einstein's mass-energy equivalence.

So interaction is not information, but a prerequisite.
Pop October 22, 2021 at 23:14 ¶ #610476
Quoting GraveItty
So interaction is not information, but a prerequisite.


It depends on your definition of information. I am saying interaction is the equivalent of information for any two entities that are interacting. That information is a change causing interaction. It is a slightly different take on information. One can ask in what sense can an entity exist on it's own? And we find it can not, it can only exist in relation to something else, so can only exist in interaction / relation. If you pose a field as a fundamental, then it is you who is interacting with that field.

The way I see it is - when two wavicles interact they integrate their information.

Unfortunately I am not familiar with gauge QFT, so cannot reply in those terms.
However you seem to know your stuff, so if you don't mind, I would be interested in an opinion on the mass-energy-information equivalence principle
GraveItty October 22, 2021 at 23:43 ¶ #610480
Quoting Pop
The way I see it is - when two wavicles interact they integrate their information.


That's undeniably true! The interaction (by massless potential energy gauge fields like the photon field) takes care of the formation of the massive matter fields by redirecting and adding massive matter kinetic energy. You can see here already somehow the equivalence between mass and energy (massive matter energy has a kinetic energy of 1/2mvexp2 while energy is equivalent to mcexp2 (how can you write math here? LaTex code). From this you can maybe see how the equivalence comes to be. I'm not sure what the connection with art is here. I haven't read this thread and mainly responded to your last comments.
Pop October 23, 2021 at 00:20 ¶ #610492
Quoting GraveItty
I'm not sure what the connection with art is here.


We have strayed somewhat off course. Thanks for confirming.

I am working on the principle that information is fundamental. Whilst I can understand this logically, I can not verify it with physics. I wonder did you get a chance to look at the link? I wonder what standing such ideas have in physics circles?

Quoting GraveItty
From this you can maybe see how the equivalence comes to be


Unfortunately not. :smile:
RussellA October 23, 2021 at 08:06 ¶ #610648
Quoting Pop
"reality"


User image
GraveItty October 23, 2021 at 08:51 ¶ #610658
Reply to RussellA

Ha, good one! My second loud laugh this morning. And behold! I woke my wife. Because of you! Damned... :smile:
GraveItty October 23, 2021 at 11:20 ¶ #610678
Reply to Pop

Hi Pop. So you are interested in the relation between mass-energy itself or in the relation between the both and information? I guess the last although they are all three intertwined. If an electron field interacts with a proton field by means of an interacting photon field, the both settle in-formation after having reduced their total energy (or mass). Some energy is sent away by means of a photon which possesses potential energy in the sense that it can give kinetic energy to matter particles or change the direction of their velocities (this last is achieved by virtual photons, which can possess zero energy but still 3-momentum changing abilities, so not changing the kinetic energy of the matter it acts on). So when a hydrogen atom is formed (a new integrated form!) the mass of this new hydrogen form is reduced by a tiny amount. Energy is set free by means of a real photon (or more). These new photons possess the potential to give kinetic energy to other matter fields, as long as they are electrically charged. That means quarks and leptons, and probably more basic ones (if the last are massless it would give a nice explanation for the equivalence between mass and energy, but that equivalence is not what you're after I guess, although it nicely fits in and has a relation to form too).

So, the hydrogen example showed how in-formation (litterally!) gives rise to a reduction in mass. This example (being simple and clear) can serve as means to understand more complex forms like a computer contains information. If it acquires more in-formation, potential energy is set free and the mass of the computer decreases. So storing in-formation in matter (or matter forming structures) generally reduces mass.
Pop October 23, 2021 at 21:08 ¶ #610814
Reply to RussellA :rofl: So true!
Pop October 23, 2021 at 21:46 ¶ #610821
Reply to GraveItty Thanks for the great reply. I'm starting to get it. I'm always expecting to encounter some major unforeseen stumbling block, but you have given me another avenue of enquiry. I will research this some more. Gauge QFT is not at all intuitive. :sad:

BTW, Welcome to the forum. :up:
GraveItty October 23, 2021 at 23:29 ¶ #610881
Reply to Pop

Thanks! Another example is the formation of cosmological structures by gravity. The interacting field here is mediated by gravitons (instead of the photons). Due to the fact that these work on spacetime (through which they move at the same time, which makes the situation somewhat complicated, but that aside) they are 2-tensor particles curving spacetime by means of which the masses in the universe can interact. Now as in the case of the hydrogen atom, virtual graviton fields can "pull" masses in-formation (they don't really pull at the masses itself as they only work on spacetime, although they can emanate from them, which is not the standard interpretation, but alas, I'm not standard too!). Spherical structures are the most popular ones up there, although galactic spirals are wanted too. Elliptical orbits (containing a bit more information than circular ones) came into fashion late in the galactic evolution. The gravitational entropy became higher though because of the release of real gravitons during the structure formation. The mass of the structures decreased by a small amount though. Because of that very formation.

Likewise, all life on Earth evolved into structures after the first gravitational formed structures had formed. How could this happen? Well, massive structures formed by gravity are necessary in the first place. Ordered structures can only form if there is a non-equilibrium state and this was certainly the case on Earth. It faces the heat and the cold in the rhythm of day and night. So... Life condensed in formation by complex mediating field generated by the complex structures themselves (self organization!).

The information in a computer is not the information contained in the zeros and ones. That's just an interpretation we put on it, relating them (the zeros and ones, which are fundamentally different from the potential spikes in the neural network in our brainy world) to other structures and calling that information about these other structures. That's the modern viewpoint on information (bits) but it's not what in-formation actually is.
Pop October 24, 2021 at 22:37 ¶ #611337
Quoting GraveItty
That's the modern viewpoint on information (bits) but it's not what in-formation actually is.


:up: Yes, I agree. Information is an inForming - literally changing the shape of, including mind. Originally this would have been meant to apply to an immaterial mind, but If we accept neural correlates of mind activity, then it is a physical informing. And this physical informing is the fundamental stuff, imo. The way order in the universe self organized, and then life, cannot be via different processes, but via the same self organization of information process.

This "inForming" understanding of information can not be found in any of the dictionaries or Wikipedia anymore, but in several older texts, circa 1950, this is roughly how they describe it.

Thanks again for the excellent explanation. I feel I have heard these words before, but not as well articulated. Normally I would love to continue this conversation, but I have pressing matters to attend to. Thanks again.
boagie October 30, 2021 at 22:44 ¶ #614742
A celabration of life and all being, as expressed through human consciousness.